Incidental Mutation 'R1406:Or4f57'
ID 188726
Institutional Source Beutler Lab
Gene Symbol Or4f57
Ensembl Gene ENSMUSG00000074952
Gene Name olfactory receptor family 4 subfamily F member 57
Synonyms MOR245-22, Olfr1308, GA_x6K02T2Q125-73008844-73007882
Accession Numbers
Essential gene? Probably non essential (E-score: 0.081) question?
Stock # R1406 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 111790454-111791416 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 111790926 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000146688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099605] [ENSMUST00000207560]
AlphaFold Q7TQX0
Predicted Effect probably benign
Transcript: ENSMUST00000099605
AA Change: V164A

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000097200
Gene: ENSMUSG00000074952
AA Change: V164A

DomainStartEndE-ValueType
Pfam:7tm_4 30 305 2.2e-39 PFAM
Pfam:7tm_1 41 287 3.1e-23 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000207560
AA Change: V164A

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,750,189 (GRCm39) T733A probably benign Het
Antxrl A G 14: 33,794,999 (GRCm39) N476D possibly damaging Het
Armc8 G T 9: 99,405,301 (GRCm39) P268Q probably benign Het
Asb8 C A 15: 98,034,304 (GRCm39) G84C probably damaging Het
BC035044 A T 6: 128,862,047 (GRCm39) probably null Het
Caprin1 A G 2: 103,606,332 (GRCm39) F303L probably benign Het
Cdh20 G A 1: 109,988,862 (GRCm39) V255I probably benign Het
Ctdspl2 G A 2: 121,837,349 (GRCm39) R371Q probably damaging Het
Dctn4 T A 18: 60,689,402 (GRCm39) D431E probably benign Het
Dhx40 T C 11: 86,688,571 (GRCm39) E284G probably benign Het
Dhx9 A G 1: 153,340,684 (GRCm39) V652A probably damaging Het
Fnip2 G T 3: 79,415,398 (GRCm39) N213K possibly damaging Het
Itch A G 2: 155,048,274 (GRCm39) E546G possibly damaging Het
Map3k20 A T 2: 72,219,838 (GRCm39) I257F probably damaging Het
Mdc1 C T 17: 36,164,424 (GRCm39) T1324I probably benign Het
Mertk T C 2: 128,613,406 (GRCm39) I474T probably benign Het
Nav3 A G 10: 109,719,495 (GRCm39) V156A possibly damaging Het
Nbea A G 3: 55,944,702 (GRCm39) V554A probably benign Het
Or10z1 T A 1: 174,078,427 (GRCm39) E22V possibly damaging Het
Or13c7c C T 4: 43,835,582 (GRCm39) V303M possibly damaging Het
Pask A G 1: 93,249,373 (GRCm39) Y676H probably benign Het
Pcare T C 17: 72,056,156 (GRCm39) N1174D probably benign Het
Plpp2 G A 10: 79,366,611 (GRCm39) probably benign Het
Rab32 A G 10: 10,426,637 (GRCm39) V103A probably damaging Het
Rp1 T C 1: 4,422,144 (GRCm39) E262G possibly damaging Het
Rtn4 A G 11: 29,658,236 (GRCm39) T797A probably benign Het
Sall1 A T 8: 89,759,072 (GRCm39) I344K probably benign Het
Scnn1b T C 7: 121,501,767 (GRCm39) probably null Het
Sik3 G T 9: 46,034,643 (GRCm39) probably benign Het
Slc7a2 G T 8: 41,358,622 (GRCm39) G322W probably damaging Het
Snx29 A G 16: 11,217,657 (GRCm39) M153V probably benign Het
Stk25 A G 1: 93,552,875 (GRCm39) probably benign Het
Stk4 C T 2: 163,942,448 (GRCm39) T360M probably benign Het
Ush1c A C 7: 45,874,965 (GRCm39) probably null Het
Vmn2r8 C T 5: 108,950,234 (GRCm39) M204I probably benign Het
Zfp839 C T 12: 110,832,744 (GRCm39) T554M probably damaging Het
Other mutations in Or4f57
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Or4f57 APN 2 111,790,620 (GRCm39) missense possibly damaging 0.84
IGL01359:Or4f57 APN 2 111,791,406 (GRCm39) missense probably benign
IGL01731:Or4f57 APN 2 111,790,980 (GRCm39) missense probably benign 0.03
IGL01788:Or4f57 APN 2 111,791,352 (GRCm39) missense probably benign
IGL02385:Or4f57 APN 2 111,790,603 (GRCm39) missense probably benign 0.00
IGL02969:Or4f57 APN 2 111,790,912 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0102:Or4f57 UTSW 2 111,790,942 (GRCm39) missense probably damaging 1.00
R0244:Or4f57 UTSW 2 111,791,361 (GRCm39) missense probably benign 0.13
R0265:Or4f57 UTSW 2 111,790,839 (GRCm39) missense probably damaging 0.99
R1268:Or4f57 UTSW 2 111,791,222 (GRCm39) missense possibly damaging 0.78
R1406:Or4f57 UTSW 2 111,790,926 (GRCm39) missense probably benign 0.07
R1568:Or4f57 UTSW 2 111,790,585 (GRCm39) missense probably benign 0.02
R2401:Or4f57 UTSW 2 111,790,494 (GRCm39) missense probably benign 0.01
R4396:Or4f57 UTSW 2 111,790,560 (GRCm39) missense probably damaging 1.00
R4528:Or4f57 UTSW 2 111,791,293 (GRCm39) missense probably damaging 1.00
R5916:Or4f57 UTSW 2 111,791,175 (GRCm39) missense probably damaging 1.00
R6332:Or4f57 UTSW 2 111,791,091 (GRCm39) missense probably damaging 0.98
R6595:Or4f57 UTSW 2 111,790,515 (GRCm39) missense possibly damaging 0.95
R7339:Or4f57 UTSW 2 111,790,956 (GRCm39) missense probably benign 0.12
R7917:Or4f57 UTSW 2 111,791,310 (GRCm39) missense probably damaging 0.98
R8017:Or4f57 UTSW 2 111,790,918 (GRCm39) missense probably damaging 0.99
R8092:Or4f57 UTSW 2 111,790,652 (GRCm39) missense probably benign 0.00
R8246:Or4f57 UTSW 2 111,790,483 (GRCm39) missense probably benign 0.05
R9389:Or4f57 UTSW 2 111,790,872 (GRCm39) missense probably damaging 1.00
R9515:Or4f57 UTSW 2 111,790,584 (GRCm39) missense possibly damaging 0.54
R9631:Or4f57 UTSW 2 111,791,377 (GRCm39) missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- AAGCCTTGGAGGAACCACTTGAAG -3'
(R):5'- TGTGGCATCTGACCCTCATTTACAC -3'

Sequencing Primer
(F):5'- GGAACCACTTGAAGAGTGTTTATG -3'
(R):5'- GCCCCCAAGATGATTTATGATCTC -3'
Posted On 2014-05-09