Incidental Mutation 'R1406:Ctdspl2'
ID188727
Institutional Source Beutler Lab
Gene Symbol Ctdspl2
Ensembl Gene ENSMUSG00000033411
Gene NameCTD (carboxy-terminal domain, RNA polymerase II, polypeptide A) small phosphatase like 2
SynonymsD2Ertd485e
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121956001-122013642 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 122006868 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glutamine at position 371 (R371Q)
Ref Sequence ENSEMBL: ENSMUSP00000106207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036647] [ENSMUST00000110572] [ENSMUST00000110574] [ENSMUST00000110578]
Predicted Effect probably damaging
Transcript: ENSMUST00000036647
AA Change: R372Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047543
Gene: ENSMUSG00000033411
AA Change: R372Q

DomainStartEndE-ValueType
CPDc 285 429 4.19e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110572
AA Change: R301Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106201
Gene: ENSMUSG00000033411
AA Change: R301Q

DomainStartEndE-ValueType
CPDc 214 358 4.19e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110574
AA Change: R372Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106203
Gene: ENSMUSG00000033411
AA Change: R372Q

DomainStartEndE-ValueType
CPDc 285 429 4.19e-71 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000110578
AA Change: R371Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000106207
Gene: ENSMUSG00000033411
AA Change: R371Q

DomainStartEndE-ValueType
CPDc 284 428 4.19e-71 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140570
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Ctdspl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Ctdspl2 APN 2 121969286 splice site probably benign
IGL02282:Ctdspl2 APN 2 121977478 splice site probably benign
IGL02934:Ctdspl2 APN 2 121979009 missense probably damaging 1.00
IGL03100:Ctdspl2 APN 2 121978913 missense probably benign 0.27
IGL03285:Ctdspl2 APN 2 121986999 missense probably damaging 0.99
R0105:Ctdspl2 UTSW 2 121977320 splice site probably benign
R0521:Ctdspl2 UTSW 2 122006887 nonsense probably null
R1406:Ctdspl2 UTSW 2 122006868 missense probably damaging 1.00
R1466:Ctdspl2 UTSW 2 122003929 missense probably benign 0.40
R1466:Ctdspl2 UTSW 2 122003929 missense probably benign 0.40
R1468:Ctdspl2 UTSW 2 121981281 missense probably benign
R1468:Ctdspl2 UTSW 2 121981281 missense probably benign
R1584:Ctdspl2 UTSW 2 122003929 missense probably benign 0.40
R2199:Ctdspl2 UTSW 2 121987029 critical splice donor site probably null
R2367:Ctdspl2 UTSW 2 121987018 missense probably benign 0.33
R4868:Ctdspl2 UTSW 2 121993398 missense possibly damaging 0.61
R5158:Ctdspl2 UTSW 2 121981293 missense probably benign 0.22
R5338:Ctdspl2 UTSW 2 121981312 missense probably benign 0.15
R5391:Ctdspl2 UTSW 2 122004148 critical splice donor site probably null
R5914:Ctdspl2 UTSW 2 121978933 missense probably damaging 1.00
R6009:Ctdspl2 UTSW 2 121988838 missense probably benign 0.01
R6196:Ctdspl2 UTSW 2 121978892 splice site probably null
R6676:Ctdspl2 UTSW 2 122006964 missense probably damaging 1.00
R7469:Ctdspl2 UTSW 2 122006881 missense possibly damaging 0.66
X0064:Ctdspl2 UTSW 2 122003947 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGCATCTGAGCTGAGCTTTCC -3'
(R):5'- GACCAAGCCCTTGCTAAAACCATCTA -3'

Sequencing Primer
(F):5'- TGACATGGTATAAACCAACATTTTTC -3'
(R):5'- ACAACCCTCTAAGTCTATCTTCAG -3'
Posted On2014-05-09