Mutagenetix > Incidental Mutation

Incidental Mutation 'R1406:Mertk'

188728

Institutional Source

Beutler Lab

Gene Symbol

Mertk

Ensembl Gene

ENSMUSG00000014361

Gene Name

c-mer proto-oncogene tyrosine kinase

Synonyms

Nyk, nmf12, Tyro 12, Eyk, Mer

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.144) question?

Stock #

R1406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

128698956-128802894 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 128771486 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Threonine at position 474 (I474T)

Ref Sequence

ENSEMBL: ENSMUSP00000014505 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014505]

AlphaFold

Q60805

Predicted Effect

probably benign
Transcript: ENSMUST00000014505
AA Change: I474T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000014505
Gene: ENSMUSG00000014361
AA Change: I474T

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
IG	94	189	8.99e-6	SMART
IG	198	276	1.54e-4	SMART
FN3	279	363	7.23e-8	SMART
FN3	379	465	6.16e-2	SMART
transmembrane domain	498	520	N/A	INTRINSIC
TyrKc	582	849	2.88e-129	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000140221

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the MER/AXL/TYRO3 receptor kinase family and encodes a transmembrane protein with two fibronectin type-III domains, two Ig-like C2-type (immunoglobulin-like) domains, and one tyrosine kinase domain. Mutations in this gene have been associated with disruption of the retinal pigment epithelium (RPE) phagocytosis pathway and onset of autosomal recessive retinitis pigmentosa (RP). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to LPS-induced shock, defective phagocytosis of apoptotic cells, lupus-like autoimmunity, degeneration of photoreceptors, decreased platelet aggregation and protection from induced pulmonary thromboembolism and thrombosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,512,749	T733A	probably benign	Het
Antxrl	A	G	14: 34,073,042	N476D	possibly damaging	Het
Armc8	G	T	9: 99,523,248	P268Q	probably benign	Het
Asb8	C	A	15: 98,136,423	G84C	probably damaging	Het
BC027072	T	C	17: 71,749,161	N1174D	probably benign	Het
BC035044	A	T	6: 128,885,084		probably null	Het
Caprin1	A	G	2: 103,775,987	F303L	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Ctdspl2	G	A	2: 122,006,868	R371Q	probably damaging	Het
Dctn4	T	A	18: 60,556,330	D431E	probably benign	Het
Dhx40	T	C	11: 86,797,745	E284G	probably benign	Het
Dhx9	A	G	1: 153,464,938	V652A	probably damaging	Het
Fnip2	G	T	3: 79,508,091	N213K	possibly damaging	Het
Itch	A	G	2: 155,206,354	E546G	possibly damaging	Het
Map3k20	A	T	2: 72,389,494	I257F	probably damaging	Het
Mdc1	C	T	17: 35,853,532	T1324I	probably benign	Het
Nav3	A	G	10: 109,883,634	V156A	possibly damaging	Het
Nbea	A	G	3: 56,037,281	V554A	probably benign	Het
Olfr1308	A	G	2: 111,960,581	V164A	probably benign	Het
Olfr157	C	T	4: 43,835,582	V303M	possibly damaging	Het
Olfr419	T	A	1: 174,250,861	E22V	possibly damaging	Het
Pask	A	G	1: 93,321,651	Y676H	probably benign	Het
Plpp2	G	A	10: 79,530,777		probably benign	Het
Rab32	A	G	10: 10,550,893	V103A	probably damaging	Het
Rp1	T	C	1: 4,351,921	E262G	possibly damaging	Het
Rtn4	A	G	11: 29,708,236	T797A	probably benign	Het
Sall1	A	T	8: 89,032,444	I344K	probably benign	Het
Scnn1b	T	C	7: 121,902,544		probably null	Het
Sik3	G	T	9: 46,123,345		probably benign	Het
Slc7a2	G	T	8: 40,905,585	G322W	probably damaging	Het
Snx29	A	G	16: 11,399,793	M153V	probably benign	Het
Stk25	A	G	1: 93,625,153		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Ush1c	A	C	7: 46,225,541		probably null	Het
Vmn2r8	C	T	5: 108,802,368	M204I	probably benign	Het
Zfp839	C	T	12: 110,866,310	T554M	probably damaging	Het

Other mutations in Mertk

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01540:Mertk	APN	2	128783967	missense	probably damaging	1.00
IGL01561:Mertk	APN	2	128736636	missense	probably damaging	1.00
IGL01873:Mertk	APN	2	128729275	missense	possibly damaging	0.93
IGL02539:Mertk	APN	2	128801290	missense	probably damaging	1.00
IGL02652:Mertk	APN	2	128801270	missense	probably benign
IGL02962:Mertk	APN	2	128777454	missense	probably damaging	1.00
IGL03237:Mertk	APN	2	128790272	missense	probably damaging	1.00
PIT4378001:Mertk	UTSW	2	128782617	critical splice donor site	probably null
R0118:Mertk	UTSW	2	128759166	missense	probably damaging	0.99
R0281:Mertk	UTSW	2	128782621	splice site	probably benign
R0491:Mertk	UTSW	2	128793107	critical splice donor site	probably null
R0565:Mertk	UTSW	2	128771483	missense	probably benign	0.20
R0628:Mertk	UTSW	2	128738313	missense	probably damaging	1.00
R1260:Mertk	UTSW	2	128762152	missense	probably benign	0.03
R1406:Mertk	UTSW	2	128771486	missense	probably benign	0.00
R1423:Mertk	UTSW	2	128778963	missense	probably damaging	1.00
R1523:Mertk	UTSW	2	128790328	critical splice donor site	probably null
R1539:Mertk	UTSW	2	128782526	missense	probably benign	0.05
R1680:Mertk	UTSW	2	128801636	missense	probably benign	0.03
R1770:Mertk	UTSW	2	128750174	missense	probably benign	0.10
R1832:Mertk	UTSW	2	128762212	missense	probably benign	0.10
R1870:Mertk	UTSW	2	128801196	missense	probably benign	0.01
R1959:Mertk	UTSW	2	128759090	missense	probably damaging	0.98
R2078:Mertk	UTSW	2	128794458	missense	probably damaging	1.00
R2125:Mertk	UTSW	2	128762138	missense	probably benign
R2178:Mertk	UTSW	2	128793064	missense	probably damaging	1.00
R2220:Mertk	UTSW	2	128801472	missense	probably benign	0.18
R4128:Mertk	UTSW	2	128777438	nonsense	probably null
R4664:Mertk	UTSW	2	128801212	missense	probably benign	0.24
R4740:Mertk	UTSW	2	128751994	missense	probably damaging	1.00
R4822:Mertk	UTSW	2	128801305	missense	probably benign	0.00
R4839:Mertk	UTSW	2	128782576	missense	probably damaging	0.97
R4874:Mertk	UTSW	2	128750159	missense	probably damaging	1.00
R4899:Mertk	UTSW	2	128783925	missense	probably damaging	1.00
R5010:Mertk	UTSW	2	128784000	missense	probably benign	0.03
R5128:Mertk	UTSW	2	128738247	missense	probably damaging	0.97
R5251:Mertk	UTSW	2	128729455	missense	probably damaging	1.00
R5276:Mertk	UTSW	2	128801314	missense	possibly damaging	0.87
R5397:Mertk	UTSW	2	128771464	missense	possibly damaging	0.86
R5575:Mertk	UTSW	2	128736565	missense	probably damaging	1.00
R5605:Mertk	UTSW	2	128738307	missense	probably benign	0.43
R5705:Mertk	UTSW	2	128771401	missense	probably benign	0.00
R5987:Mertk	UTSW	2	128771374	missense	probably benign	0.01
R6127:Mertk	UTSW	2	128738291	missense	probably damaging	0.99
R6556:Mertk	UTSW	2	128776421	missense	probably benign	0.23
R6671:Mertk	UTSW	2	128752023	critical splice donor site	probably null
R6674:Mertk	UTSW	2	128729357	missense	probably benign
R6841:Mertk	UTSW	2	128759230	splice site	probably null
R7153:Mertk	UTSW	2	128736649	missense	probably damaging	0.99
R7192:Mertk	UTSW	2	128793108	splice site	probably null
R7225:Mertk	UTSW	2	128801562	missense	possibly damaging	0.94
R7344:Mertk	UTSW	2	128771497	missense	probably benign
R7414:Mertk	UTSW	2	128729393	missense	possibly damaging	0.95
R7883:Mertk	UTSW	2	128776345	missense	probably benign	0.01
R8000:Mertk	UTSW	2	128771498	missense	probably benign
R8953:Mertk	UTSW	2	128778796	intron	probably benign
R9135:Mertk	UTSW	2	128762115	missense	probably benign	0.23
R9153:Mertk	UTSW	2	128782567	missense	probably damaging	1.00
R9176:Mertk	UTSW	2	128778972	missense	possibly damaging	0.62
R9443:Mertk	UTSW	2	128762109	missense	probably benign	0.00
R9574:Mertk	UTSW	2	128751960	missense	probably benign	0.03
R9582:Mertk	UTSW	2	128782607	missense	possibly damaging	0.55
R9616:Mertk	UTSW	2	128801335	missense	probably benign	0.01
X0067:Mertk	UTSW	2	128729567	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AACTGTGGGCAATGTGGGTAGC -3'
(R):5'- GCAAACCAACTGTGCCAGTGAGAG -3'

Sequencing Primer
(F):5'- TAGCTGTCTAGTGAGCCACC -3'
(R):5'- GGTGTCATGGGCCTTAAACC -3'

Posted On

2014-05-09