Incidental Mutation 'R1406:Itch'
ID188729
Institutional Source Beutler Lab
Gene Symbol Itch
Ensembl Gene ENSMUSG00000027598
Gene Nameitchy, E3 ubiquitin protein ligase
Synonyms8030492O04Rik, C230047C07Rik, 6720481N21Rik, AIP4
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location155133509-155226855 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 155206354 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 546 (E546G)
Ref Sequence ENSEMBL: ENSMUSP00000105307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029126] [ENSMUST00000109685]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029126
AA Change: E546G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029126
Gene: ENSMUSG00000027598
AA Change: E546G

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000109685
AA Change: E546G

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000105307
Gene: ENSMUSG00000027598
AA Change: E546G

DomainStartEndE-ValueType
C2 19 114 3.56e-12 SMART
low complexity region 195 206 N/A INTRINSIC
low complexity region 209 226 N/A INTRINSIC
low complexity region 230 259 N/A INTRINSIC
WW 288 320 1.07e-12 SMART
WW 321 352 3.86e-10 SMART
WW 400 432 7.36e-16 SMART
WW 440 472 6.82e-11 SMART
HECTc 528 864 7.04e-179 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123497
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142147
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of HECT domain E3 ubiquitin ligases. HECT domain E3 ubiquitin ligases transfer ubiquitin from E2 ubiquitin-conjugating enzymes to protein substrates, thus targeting specific proteins for lysosomal degradation. The encoded protein plays a role in multiple cellular processes including erythroid and lymphoid cell differentiation and the regulation of immune responses. Mutations in this gene are a cause of syndromic multisystem autoimmune disease. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Mice homozygous for an ENU mutation exhibit increased total IgE levels in the peripheral blood and an enhanced IgE response to the cysteine protease allergen, papain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Itch
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Itch APN 2 155213023 missense probably damaging 1.00
IGL00796:Itch APN 2 155209082 missense probably damaging 0.97
IGL01090:Itch APN 2 155206336 missense probably damaging 0.99
IGL01568:Itch APN 2 155212462 splice site probably benign
IGL01844:Itch APN 2 155172547 missense possibly damaging 0.56
IGL01844:Itch APN 2 155172486 missense possibly damaging 0.94
IGL01873:Itch APN 2 155168750 missense possibly damaging 0.68
IGL02129:Itch APN 2 155217988 splice site probably benign
IGL02386:Itch APN 2 155202261 nonsense probably null
IGL02545:Itch APN 2 155172586 splice site probably null
IGL02621:Itch APN 2 155172584 splice site probably null
IGL02708:Itch APN 2 155174044 missense probably benign 0.00
IGL02869:Itch APN 2 155173933 critical splice acceptor site probably null
Abrade UTSW 2 155209078 missense possibly damaging 0.93
scratch UTSW 2 155172561 missense probably damaging 0.99
R0116:Itch UTSW 2 155217983 splice site probably benign
R0207:Itch UTSW 2 155202257 missense probably benign
R0226:Itch UTSW 2 155199394 missense probably benign 0.01
R0545:Itch UTSW 2 155182298 nonsense probably null
R0689:Itch UTSW 2 155182178 missense possibly damaging 0.82
R1365:Itch UTSW 2 155213031 missense probably benign 0.00
R1406:Itch UTSW 2 155206354 missense possibly damaging 0.95
R1436:Itch UTSW 2 155192145 missense probably damaging 0.96
R1639:Itch UTSW 2 155179025 intron probably null
R1769:Itch UTSW 2 155172561 missense probably damaging 0.99
R1855:Itch UTSW 2 155172454 splice site probably benign
R1865:Itch UTSW 2 155168746 missense probably damaging 0.96
R2008:Itch UTSW 2 155210459 missense possibly damaging 0.91
R2054:Itch UTSW 2 155210576 missense probably damaging 1.00
R2196:Itch UTSW 2 155202221 missense probably benign
R2199:Itch UTSW 2 155202221 missense probably benign
R2252:Itch UTSW 2 155212339 missense probably benign 0.01
R2253:Itch UTSW 2 155212339 missense probably benign 0.01
R2348:Itch UTSW 2 155209078 missense possibly damaging 0.93
R2850:Itch UTSW 2 155202221 missense probably benign
R3021:Itch UTSW 2 155209126 missense possibly damaging 0.74
R4676:Itch UTSW 2 155199435 missense probably benign 0.05
R4716:Itch UTSW 2 155210582 critical splice donor site probably null
R4888:Itch UTSW 2 155217977 splice site probably null
R4970:Itch UTSW 2 155185593 missense possibly damaging 0.50
R6029:Itch UTSW 2 155179089 critical splice donor site probably null
R6122:Itch UTSW 2 155174065 missense probably benign 0.05
R6435:Itch UTSW 2 155209129 missense probably benign 0.01
R6449:Itch UTSW 2 155163395 splice site probably benign
R7069:Itch UTSW 2 155209994 missense probably damaging 1.00
R7083:Itch UTSW 2 155210444 missense probably damaging 1.00
R7409:Itch UTSW 2 155199382 missense probably damaging 0.99
R7689:Itch UTSW 2 155210002 missense probably damaging 0.99
R7689:Itch UTSW 2 155213067 missense probably benign 0.00
R8046:Itch UTSW 2 155210502 missense probably damaging 1.00
R8248:Itch UTSW 2 155206383 critical splice donor site probably null
Z1177:Itch UTSW 2 155209059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTAAGTCACCTACAGTGGAGCAAG -3'
(R):5'- GTAATCCTGTCACGCAATAAGCAAAGC -3'

Sequencing Primer
(F):5'- CTACAGTGGAGCAAGTGGGAG -3'
(R):5'- tcgtcatctgtaagattctctacc -3'
Posted On2014-05-09