Incidental Mutation 'R1406:Olfr157'
ID188733
Institutional Source Beutler Lab
Gene Symbol Olfr157
Ensembl Gene ENSMUSG00000111611
Gene Nameolfactory receptor 157
SynonymsOR37C, mOR37c, Olfr37c, GA_x6K02T2N78B-16110014-16110970, MOR262-12
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location43830542-43840201 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 43835582 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 303 (V303M)
Ref Sequence ENSEMBL: ENSMUSP00000150429 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079234] [ENSMUST00000214281] [ENSMUST00000215442]
Predicted Effect possibly damaging
Transcript: ENSMUST00000079234
AA Change: V303M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000078226
Gene: ENSMUSG00000110970
AA Change: V303M

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 4.8e-58 PFAM
Pfam:7tm_1 41 296 2.9e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214281
AA Change: V303M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000215442
AA Change: V303M

PolyPhen 2 Score 0.691 (Sensitivity: 0.86; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Olfr157
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01138:Olfr157 APN 4 43835617 missense probably damaging 1.00
R1406:Olfr157 UTSW 4 43835582 missense possibly damaging 0.69
R4386:Olfr157 UTSW 4 43836124 missense probably benign 0.44
R4673:Olfr157 UTSW 4 43836430 missense probably benign 0.28
R5119:Olfr157 UTSW 4 43836433 missense probably benign
R5150:Olfr157 UTSW 4 43836301 missense probably damaging 1.00
R5379:Olfr157 UTSW 4 43836010 missense probably benign
R6027:Olfr157 UTSW 4 43835842 missense probably benign 0.03
R6542:Olfr157 UTSW 4 43835686 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAGATGTTGGCAGTCACTGACAGG -3'
(R):5'- CCATCCTCTTCATGTACGGGAAGC -3'

Sequencing Primer
(F):5'- aaaatgaactttcccagtcagtag -3'
(R):5'- TTCATGTACGGGAAGCCCAAG -3'
Posted On2014-05-09