Mutagenetix > Incidental Mutation

Incidental Mutation 'R1406:Vmn2r8'

188734

Institutional Source

Beutler Lab

Gene Symbol

Vmn2r8

Ensembl Gene

ENSMUSG00000090961

Gene Name

vomeronasal 2, receptor 8

Synonyms

EG627479

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.063) question?

Stock #

R1406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108797193-108808754 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 108802368 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 204 (M204I)

Ref Sequence

ENSEMBL: ENSMUSP00000126953 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000172140]

AlphaFold

L7N472

Predicted Effect

probably benign
Transcript: ENSMUST00000172140
AA Change: M204I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000126953
Gene: ENSMUSG00000090961
AA Change: M204I

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
Pfam:ANF_receptor	78	419	1.1e-28	PFAM
Pfam:NCD3G	507	561	8.2e-18	PFAM
Pfam:7tm_3	594	829	1.1e-54	PFAM

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Akap11	T	C	14: 78,512,749	T733A	probably benign	Het
Antxrl	A	G	14: 34,073,042	N476D	possibly damaging	Het
Armc8	G	T	9: 99,523,248	P268Q	probably benign	Het
Asb8	C	A	15: 98,136,423	G84C	probably damaging	Het
BC027072	T	C	17: 71,749,161	N1174D	probably benign	Het
BC035044	A	T	6: 128,885,084		probably null	Het
Caprin1	A	G	2: 103,775,987	F303L	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Ctdspl2	G	A	2: 122,006,868	R371Q	probably damaging	Het
Dctn4	T	A	18: 60,556,330	D431E	probably benign	Het
Dhx40	T	C	11: 86,797,745	E284G	probably benign	Het
Dhx9	A	G	1: 153,464,938	V652A	probably damaging	Het
Fnip2	G	T	3: 79,508,091	N213K	possibly damaging	Het
Itch	A	G	2: 155,206,354	E546G	possibly damaging	Het
Map3k20	A	T	2: 72,389,494	I257F	probably damaging	Het
Mdc1	C	T	17: 35,853,532	T1324I	probably benign	Het
Mertk	T	C	2: 128,771,486	I474T	probably benign	Het
Nav3	A	G	10: 109,883,634	V156A	possibly damaging	Het
Nbea	A	G	3: 56,037,281	V554A	probably benign	Het
Olfr1308	A	G	2: 111,960,581	V164A	probably benign	Het
Olfr157	C	T	4: 43,835,582	V303M	possibly damaging	Het
Olfr419	T	A	1: 174,250,861	E22V	possibly damaging	Het
Pask	A	G	1: 93,321,651	Y676H	probably benign	Het
Plpp2	G	A	10: 79,530,777		probably benign	Het
Rab32	A	G	10: 10,550,893	V103A	probably damaging	Het
Rp1	T	C	1: 4,351,921	E262G	possibly damaging	Het
Rtn4	A	G	11: 29,708,236	T797A	probably benign	Het
Sall1	A	T	8: 89,032,444	I344K	probably benign	Het
Scnn1b	T	C	7: 121,902,544		probably null	Het
Sik3	G	T	9: 46,123,345		probably benign	Het
Slc7a2	G	T	8: 40,905,585	G322W	probably damaging	Het
Snx29	A	G	16: 11,399,793	M153V	probably benign	Het
Stk25	A	G	1: 93,625,153		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Ush1c	A	C	7: 46,225,541		probably null	Het
Zfp839	C	T	12: 110,866,310	T554M	probably damaging	Het

Other mutations in Vmn2r8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02957:Vmn2r8	APN	5	108802225	missense	probably benign	0.01
R0324:Vmn2r8	UTSW	5	108797941	splice site	probably null
R0335:Vmn2r8	UTSW	5	108797451	splice site	probably null
R0394:Vmn2r8	UTSW	5	108802072	missense	probably benign	0.12
R0501:Vmn2r8	UTSW	5	108803183	missense	probably benign	0.03
R0615:Vmn2r8	UTSW	5	108799329	missense	probably damaging	1.00
R0678:Vmn2r8	UTSW	5	108800546	missense	probably benign	0.00
R1167:Vmn2r8	UTSW	5	108803176	missense	probably benign	0.01
R1187:Vmn2r8	UTSW	5	108803219	nonsense	probably null
R1406:Vmn2r8	UTSW	5	108802368	missense	probably benign
R1451:Vmn2r8	UTSW	5	108798067	missense	probably damaging	1.00
R1535:Vmn2r8	UTSW	5	108802174	missense	probably damaging	1.00
R1795:Vmn2r8	UTSW	5	108803106	missense	probably benign
R1874:Vmn2r8	UTSW	5	108802418	missense	possibly damaging	0.74
R1908:Vmn2r8	UTSW	5	108797570	missense	probably benign	0.03
R1925:Vmn2r8	UTSW	5	108802153	missense	probably damaging	0.97
R1960:Vmn2r8	UTSW	5	108799286	missense	probably damaging	0.99
R1961:Vmn2r8	UTSW	5	108798095	missense	probably benign	0.45
R1967:Vmn2r8	UTSW	5	108802383	missense	probably benign	0.01
R2095:Vmn2r8	UTSW	5	108808621	missense	possibly damaging	0.94
R2159:Vmn2r8	UTSW	5	108802303	missense	probably benign	0.22
R4240:Vmn2r8	UTSW	5	108797503	missense	probably damaging	0.99
R4581:Vmn2r8	UTSW	5	108801704	missense	probably benign	0.03
R4744:Vmn2r8	UTSW	5	108808581	missense	probably benign	0.00
R4755:Vmn2r8	UTSW	5	108801700	missense	probably benign	0.03
R4917:Vmn2r8	UTSW	5	108797398	missense	probably damaging	1.00
R4957:Vmn2r8	UTSW	5	108799263	missense	probably benign	0.16
R5141:Vmn2r8	UTSW	5	108808706	missense	probably damaging	0.96
R5481:Vmn2r8	UTSW	5	108801770	missense	probably benign	0.09
R5571:Vmn2r8	UTSW	5	108802240	missense	probably damaging	1.00
R5624:Vmn2r8	UTSW	5	108802459	missense	probably damaging	0.99
R6003:Vmn2r8	UTSW	5	108797382	missense	probably damaging	1.00
R6243:Vmn2r8	UTSW	5	108799345	missense	probably benign	0.01
R6265:Vmn2r8	UTSW	5	108808597	missense	probably benign
R6315:Vmn2r8	UTSW	5	108801891	missense	probably benign
R6413:Vmn2r8	UTSW	5	108801723	missense	probably benign	0.09
R7120:Vmn2r8	UTSW	5	108808638	missense	possibly damaging	0.56
R7406:Vmn2r8	UTSW	5	108800576	missense	probably benign	0.00
R7409:Vmn2r8	UTSW	5	108808583	nonsense	probably null
R7489:Vmn2r8	UTSW	5	108797656	missense	possibly damaging	0.95
R7532:Vmn2r8	UTSW	5	108802240	missense	probably benign	0.22
R7534:Vmn2r8	UTSW	5	108802174	missense	possibly damaging	0.94
R7739:Vmn2r8	UTSW	5	108802177	missense	probably damaging	1.00
R8099:Vmn2r8	UTSW	5	108801834	missense	probably benign
R8245:Vmn2r8	UTSW	5	108798070	missense	probably damaging	1.00
R8711:Vmn2r8	UTSW	5	108798096	missense	possibly damaging	0.89
R8781:Vmn2r8	UTSW	5	108797731	missense	possibly damaging	0.95
R8874:Vmn2r8	UTSW	5	108808751	missense	probably damaging	1.00
R8927:Vmn2r8	UTSW	5	108802265	missense
R8928:Vmn2r8	UTSW	5	108802265	missense
R9288:Vmn2r8	UTSW	5	108802319	missense	probably benign	0.39
R9596:Vmn2r8	UTSW	5	108799330	missense	possibly damaging	0.94
R9652:Vmn2r8	UTSW	5	108803241	missense	probably benign	0.18
Z1088:Vmn2r8	UTSW	5	108801998	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CCACCTTCTAAAGCTGACTTCTAGGGTA -3'
(R):5'- CCACAACATTCAGACTTCTCAGGGATAC -3'

Sequencing Primer
(F):5'- TCTAGGGTAGAGTTCATTTCACC -3'
(R):5'- TCAGACTTCTCAGGGATACTCTAGAC -3'

Posted On

2014-05-09