Incidental Mutation 'R1406:BC035044'
ID188735
Institutional Source Beutler Lab
Gene Symbol BC035044
Ensembl Gene ENSMUSG00000090164
Gene NamecDNA sequence BC035044
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location128849090-128891126 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) A to T at 128885084 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000137315 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032519] [ENSMUST00000159866] [ENSMUST00000160290] [ENSMUST00000160290] [ENSMUST00000160867] [ENSMUST00000162666] [ENSMUST00000178918] [ENSMUST00000178918]
Predicted Effect probably benign
Transcript: ENSMUST00000032519
SMART Domains Protein: ENSMUSP00000032519
Gene: ENSMUSG00000030365

DomainStartEndE-ValueType
transmembrane domain 54 76 N/A INTRINSIC
CLECT 92 203 3.78e-20 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159080
Predicted Effect probably benign
Transcript: ENSMUST00000159866
SMART Domains Protein: ENSMUSP00000123804
Gene: ENSMUSG00000030365

DomainStartEndE-ValueType
transmembrane domain 58 80 N/A INTRINSIC
CLECT 96 207 3.78e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000160290
Predicted Effect probably null
Transcript: ENSMUST00000160290
Predicted Effect probably benign
Transcript: ENSMUST00000160867
SMART Domains Protein: ENSMUSP00000145115
Gene: ENSMUSG00000030365

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CLECT 31 142 1.9e-22 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162666
SMART Domains Protein: ENSMUSP00000124910
Gene: ENSMUSG00000030365

DomainStartEndE-ValueType
transmembrane domain 83 105 N/A INTRINSIC
CLECT 121 232 3.78e-20 SMART
Predicted Effect probably null
Transcript: ENSMUST00000178918
Predicted Effect probably null
Transcript: ENSMUST00000178918
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203621
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in BC035044
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1406:BC035044 UTSW 6 128885084 splice site probably null
R1543:BC035044 UTSW 6 128890985 start gained probably benign
R2147:BC035044 UTSW 6 128890904 intron probably benign
R3727:BC035044 UTSW 6 128890859 nonsense probably null
R4115:BC035044 UTSW 6 128890850 intron probably benign
R5102:BC035044 UTSW 6 128884986 unclassified probably benign
R5431:BC035044 UTSW 6 128885007 unclassified probably benign
R6180:BC035044 UTSW 6 128885034 unclassified probably benign
R6273:BC035044 UTSW 6 128890889 intron probably benign
R6467:BC035044 UTSW 6 128890892 intron probably benign
X0025:BC035044 UTSW 6 128890841 intron probably benign
X0028:BC035044 UTSW 6 128890864 intron probably benign
Predicted Primers PCR Primer
(F):5'- ACTGATTTCGGCCTATTGACCATCCA -3'
(R):5'- gGGCATcagattctttctgttcatgcta -3'

Sequencing Primer
(F):5'- CTATTGTAAGAGCCAGTCAGTGC -3'
(R):5'- gttcatgctaagcacatgacc -3'
Posted On2014-05-09