Incidental Mutation 'R1406:Plpp2'
ID188743
Institutional Source Beutler Lab
Gene Symbol Plpp2
Ensembl Gene ENSMUSG00000052151
Gene Namephospholipid phosphatase 2
SynonymsLpp2, Ppap2c
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location79526430-79533796 bp(-) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) G to A at 79530777 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151683 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063879] [ENSMUST00000165233] [ENSMUST00000166804] [ENSMUST00000218241]
Predicted Effect probably benign
Transcript: ENSMUST00000063879
SMART Domains Protein: ENSMUSP00000069670
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
low complexity region 6 20 N/A INTRINSIC
Blast:acidPPc 21 70 6e-9 BLAST
acidPPc 99 239 1.42e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163602
Predicted Effect probably benign
Transcript: ENSMUST00000165233
SMART Domains Protein: ENSMUSP00000127000
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166804
SMART Domains Protein: ENSMUSP00000133247
Gene: ENSMUSG00000052151

DomainStartEndE-ValueType
transmembrane domain 4 23 N/A INTRINSIC
acidPPc 43 183 1.42e-41 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184212
Predicted Effect probably benign
Transcript: ENSMUST00000218241
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a lipid phosphate phosphohydrolase. It is an integral membrane protein that catalyzes the conversion of phosphatidic acid to diacylglycerol and inorganic phosphate. The transcript is expressed at high levels in lung, liver, and kidney and at low levels in brain and heart. Null mutant mice are viable and fertile and display no overt phenotypic defects. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display a normal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Plpp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01321:Plpp2 APN 10 79527493 missense probably damaging 1.00
IGL03327:Plpp2 APN 10 79530984 splice site probably null
Trust UTSW 10 79530929 missense probably damaging 1.00
R0009:Plpp2 UTSW 10 79527244 missense probably benign 0.01
R0056:Plpp2 UTSW 10 79527229 missense probably damaging 0.99
R0097:Plpp2 UTSW 10 79530537 missense possibly damaging 0.50
R0311:Plpp2 UTSW 10 79527580 missense probably damaging 0.97
R0840:Plpp2 UTSW 10 79527544 missense probably benign 0.16
R1642:Plpp2 UTSW 10 79530684 missense probably damaging 1.00
R3436:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R3437:Plpp2 UTSW 10 79527813 critical splice donor site probably null
R4400:Plpp2 UTSW 10 79527493 missense possibly damaging 0.88
R4521:Plpp2 UTSW 10 79530625 missense probably damaging 1.00
R4873:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R4875:Plpp2 UTSW 10 79530929 missense probably damaging 1.00
R5114:Plpp2 UTSW 10 79527139 missense probably benign 0.41
R6970:Plpp2 UTSW 10 79530546 missense possibly damaging 0.90
R7383:Plpp2 UTSW 10 79531007 missense probably null 0.99
R7902:Plpp2 UTSW 10 79527544 missense possibly damaging 0.91
R7985:Plpp2 UTSW 10 79527544 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TGCACATAGCCAGAACAGTTGACC -3'
(R):5'- TGGTGAATGCACCATATAAGCGGG -3'

Sequencing Primer
(F):5'- AGAACAGTTGACCTGGCTC -3'
(R):5'- CACCATATAAGCGGGGGTTCTAC -3'
Posted On2014-05-09