Incidental Mutation 'R1406:Antxrl'
ID188748
Institutional Source Beutler Lab
Gene Symbol Antxrl
Ensembl Gene ENSMUSG00000047441
Gene Nameanthrax toxin receptor-like
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location34052707-34076405 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 34073042 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 476 (N476D)
Ref Sequence ENSEMBL: ENSMUSP00000052816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058725] [ENSMUST00000178958]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058725
AA Change: N476D

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000052816
Gene: ENSMUSG00000047441
AA Change: N476D

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
VWA 74 248 2.9e-19 SMART
Pfam:Anth_Ig 249 351 6.7e-41 PFAM
low complexity region 370 381 N/A INTRINSIC
low complexity region 392 461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000178958
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215823
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Akap11 T C 14: 78,512,749 T733A probably benign Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Antxrl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01344:Antxrl APN 14 34075597 missense probably benign 0.01
IGL01632:Antxrl APN 14 34067947 missense probably damaging 0.99
IGL02379:Antxrl APN 14 34056535 splice site probably null
IGL02381:Antxrl APN 14 34056611 unclassified probably null
IGL02736:Antxrl APN 14 34056618 unclassified probably benign
R0631:Antxrl UTSW 14 34058801 critical splice donor site probably null
R1190:Antxrl UTSW 14 34069250 missense probably benign 0.00
R1406:Antxrl UTSW 14 34073042 missense possibly damaging 0.53
R1454:Antxrl UTSW 14 34060949 missense probably damaging 0.99
R1469:Antxrl UTSW 14 34067431 intron probably benign
R1638:Antxrl UTSW 14 34070496 critical splice donor site probably null
R1996:Antxrl UTSW 14 34075829 missense probably benign 0.01
R2174:Antxrl UTSW 14 34060400 missense probably damaging 1.00
R2421:Antxrl UTSW 14 34071689 intron probably benign
R3850:Antxrl UTSW 14 34067381 missense probably benign 0.00
R4178:Antxrl UTSW 14 34054971 unclassified probably null
R4434:Antxrl UTSW 14 34071617 intron probably benign
R4603:Antxrl UTSW 14 34075835 missense possibly damaging 0.72
R4769:Antxrl UTSW 14 34073070 missense possibly damaging 0.53
R6003:Antxrl UTSW 14 34075635 missense possibly damaging 0.72
R6047:Antxrl UTSW 14 34053476 intron probably benign
R6228:Antxrl UTSW 14 34056599 missense probably damaging 1.00
R6363:Antxrl UTSW 14 34069287 missense probably damaging 1.00
R6525:Antxrl UTSW 14 34060406 missense probably damaging 1.00
R6800:Antxrl UTSW 14 34065907 missense probably damaging 1.00
R6933:Antxrl UTSW 14 34075771 missense possibly damaging 0.53
R7086:Antxrl UTSW 14 34065916 missense probably benign 0.26
R7257:Antxrl UTSW 14 34065849 missense probably benign 0.03
R7315:Antxrl UTSW 14 34071547 missense unknown
X0028:Antxrl UTSW 14 34053915 critical splice donor site probably null
Z1088:Antxrl UTSW 14 34067971 missense probably damaging 1.00
Z1177:Antxrl UTSW 14 34067930 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCCAGACACCCAGGTCTTTAGACTG -3'
(R):5'- TGAAGCCCTGCTGAGTTACTGTCC -3'

Sequencing Primer
(F):5'- TTAGACTGGTCTCTCTCTGGAG -3'
(R):5'- ACTTTGTGCCTTGAAGAACCAC -3'
Posted On2014-05-09