Incidental Mutation 'R1406:Akap11'
ID188749
Institutional Source Beutler Lab
Gene Symbol Akap11
Ensembl Gene ENSMUSG00000022016
Gene NameA kinase (PRKA) anchor protein 11
Synonyms6330501D17Rik
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1406 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location78492246-78536808 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 78512749 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 733 (T733A)
Ref Sequence ENSEMBL: ENSMUSP00000116015 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]
Predicted Effect probably benign
Transcript: ENSMUST00000022593
AA Change: T733A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: T733A

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1738 1755 N/A INTRINSIC
low complexity region 1767 1788 N/A INTRINSIC
Blast:AKAP_110 1790 1883 2e-8 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000123853
AA Change: T733A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: T733A

DomainStartEndE-ValueType
low complexity region 108 121 N/A INTRINSIC
low complexity region 170 179 N/A INTRINSIC
low complexity region 265 275 N/A INTRINSIC
low complexity region 302 318 N/A INTRINSIC
low complexity region 344 365 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 609 623 N/A INTRINSIC
low complexity region 727 741 N/A INTRINSIC
low complexity region 1161 1173 N/A INTRINSIC
low complexity region 1597 1614 N/A INTRINSIC
low complexity region 1631 1648 N/A INTRINSIC
low complexity region 1731 1756 N/A INTRINSIC
low complexity region 1768 1789 N/A INTRINSIC
Blast:AKAP_110 1791 1884 2e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226416
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227722
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.7%
  • 20x: 93.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Antxrl A G 14: 34,073,042 N476D possibly damaging Het
Armc8 G T 9: 99,523,248 P268Q probably benign Het
Asb8 C A 15: 98,136,423 G84C probably damaging Het
BC027072 T C 17: 71,749,161 N1174D probably benign Het
BC035044 A T 6: 128,885,084 probably null Het
Caprin1 A G 2: 103,775,987 F303L probably benign Het
Cdh7 G A 1: 110,061,132 V255I probably benign Het
Ctdspl2 G A 2: 122,006,868 R371Q probably damaging Het
Dctn4 T A 18: 60,556,330 D431E probably benign Het
Dhx40 T C 11: 86,797,745 E284G probably benign Het
Dhx9 A G 1: 153,464,938 V652A probably damaging Het
Fnip2 G T 3: 79,508,091 N213K possibly damaging Het
Itch A G 2: 155,206,354 E546G possibly damaging Het
Map3k20 A T 2: 72,389,494 I257F probably damaging Het
Mdc1 C T 17: 35,853,532 T1324I probably benign Het
Mertk T C 2: 128,771,486 I474T probably benign Het
Nav3 A G 10: 109,883,634 V156A possibly damaging Het
Nbea A G 3: 56,037,281 V554A probably benign Het
Olfr1308 A G 2: 111,960,581 V164A probably benign Het
Olfr157 C T 4: 43,835,582 V303M possibly damaging Het
Olfr419 T A 1: 174,250,861 E22V possibly damaging Het
Pask A G 1: 93,321,651 Y676H probably benign Het
Plpp2 G A 10: 79,530,777 probably benign Het
Rab32 A G 10: 10,550,893 V103A probably damaging Het
Rp1 T C 1: 4,351,921 E262G possibly damaging Het
Rtn4 A G 11: 29,708,236 T797A probably benign Het
Sall1 A T 8: 89,032,444 I344K probably benign Het
Scnn1b T C 7: 121,902,544 probably null Het
Sik3 G T 9: 46,123,345 probably benign Het
Slc7a2 G T 8: 40,905,585 G322W probably damaging Het
Snx29 A G 16: 11,399,793 M153V probably benign Het
Stk25 A G 1: 93,625,153 probably benign Het
Stk4 C T 2: 164,100,528 T360M probably benign Het
Ush1c A C 7: 46,225,541 probably null Het
Vmn2r8 C T 5: 108,802,368 M204I probably benign Het
Zfp839 C T 12: 110,866,310 T554M probably damaging Het
Other mutations in Akap11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00672:Akap11 APN 14 78511341 missense probably damaging 1.00
IGL00902:Akap11 APN 14 78495838 missense probably benign 0.11
IGL01752:Akap11 APN 14 78509878 critical splice donor site probably null
IGL01972:Akap11 APN 14 78507857 missense probably damaging 0.99
IGL02031:Akap11 APN 14 78513813 missense possibly damaging 0.50
IGL02239:Akap11 APN 14 78513849 missense probably damaging 1.00
IGL02528:Akap11 APN 14 78510867 missense probably damaging 1.00
IGL02884:Akap11 APN 14 78498962 missense probably benign 0.02
IGL03130:Akap11 APN 14 78510368 nonsense probably null
IGL03179:Akap11 APN 14 78507740 missense probably benign 0.00
IGL03240:Akap11 APN 14 78495905 missense probably damaging 0.99
IGL03331:Akap11 APN 14 78513865 missense probably damaging 1.00
bonham UTSW 14 78498864 nonsense probably null
R0004:Akap11 UTSW 14 78514940 missense possibly damaging 0.65
R0020:Akap11 UTSW 14 78518177 missense probably benign 0.37
R0200:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0281:Akap11 UTSW 14 78510089 missense possibly damaging 0.84
R0320:Akap11 UTSW 14 78513379 missense probably benign
R0381:Akap11 UTSW 14 78513550 missense probably benign 0.01
R0536:Akap11 UTSW 14 78514024 missense probably damaging 1.00
R0608:Akap11 UTSW 14 78510753 missense probably benign 0.00
R0735:Akap11 UTSW 14 78510078 missense probably damaging 1.00
R1189:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1400:Akap11 UTSW 14 78513962 missense probably damaging 1.00
R1406:Akap11 UTSW 14 78512749 missense probably benign
R1501:Akap11 UTSW 14 78513347 missense probably benign 0.11
R1588:Akap11 UTSW 14 78510245 missense possibly damaging 0.50
R1717:Akap11 UTSW 14 78513348 missense probably benign 0.02
R1823:Akap11 UTSW 14 78511488 missense probably damaging 1.00
R1847:Akap11 UTSW 14 78513661 missense probably benign 0.00
R1874:Akap11 UTSW 14 78511866 missense probably benign 0.14
R2031:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2032:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2276:Akap11 UTSW 14 78510037 missense possibly damaging 0.86
R2763:Akap11 UTSW 14 78518892 missense probably damaging 0.98
R4483:Akap11 UTSW 14 78510259 missense probably damaging 1.00
R4582:Akap11 UTSW 14 78511929 missense possibly damaging 0.81
R4857:Akap11 UTSW 14 78498860 missense
R4922:Akap11 UTSW 14 78512780 nonsense probably null
R4993:Akap11 UTSW 14 78512968 missense probably damaging 1.00
R5426:Akap11 UTSW 14 78498864 nonsense probably null
R5472:Akap11 UTSW 14 78513429 missense probably benign 0.03
R5683:Akap11 UTSW 14 78512578 missense probably damaging 0.98
R5774:Akap11 UTSW 14 78510967 missense probably damaging 1.00
R6014:Akap11 UTSW 14 78512499 missense probably benign 0.00
R6264:Akap11 UTSW 14 78512421 missense possibly damaging 0.68
R6270:Akap11 UTSW 14 78518799 missense probably damaging 1.00
R6319:Akap11 UTSW 14 78513538 missense probably benign 0.06
R6376:Akap11 UTSW 14 78514896 missense probably damaging 1.00
R6394:Akap11 UTSW 14 78522589 critical splice donor site probably null
R6536:Akap11 UTSW 14 78511314 missense possibly damaging 0.81
R7048:Akap11 UTSW 14 78512514 missense
R7147:Akap11 UTSW 14 78511465 missense
R7473:Akap11 UTSW 14 78513888 missense
R7503:Akap11 UTSW 14 78512001 missense
R7542:Akap11 UTSW 14 78510292 missense
R7618:Akap11 UTSW 14 78498860 missense
R7679:Akap11 UTSW 14 78514816 missense
R8094:Akap11 UTSW 14 78512973 missense
R8098:Akap11 UTSW 14 78512922 missense
Predicted Primers PCR Primer
(F):5'- GTTCTTGGGTAGAGCCACCACTTG -3'
(R):5'- CACCTGCATCTTCACAGTGTCAGTC -3'

Sequencing Primer
(F):5'- GCTTTACTAGGCTCAGATGAAAGAC -3'
(R):5'- CACAGTGTCAGTCATTTGACTTTG -3'
Posted On2014-05-09