Mutagenetix > Incidental Mutation

Incidental Mutation 'R1406:Akap11'

188749

Institutional Source

Beutler Lab

Gene Symbol

Akap11

Ensembl Gene

ENSMUSG00000022016

Gene Name

A kinase (PRKA) anchor protein 11

Synonyms

6330501D17Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1406 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

78492246-78536808 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 78512749 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 733 (T733A)

Ref Sequence

ENSEMBL: ENSMUSP00000116015 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000022593] [ENSMUST00000123853]

AlphaFold

E9Q777

Predicted Effect

probably benign
Transcript: ENSMUST00000022593
AA Change: T733A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000022593
Gene: ENSMUSG00000022016
AA Change: T733A

Domain	Start	End	E-Value	Type
low complexity region	108	121	N/A	INTRINSIC
low complexity region	170	179	N/A	INTRINSIC
low complexity region	265	275	N/A	INTRINSIC
low complexity region	302	318	N/A	INTRINSIC
low complexity region	344	365	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	609	623	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
low complexity region	1161	1173	N/A	INTRINSIC
low complexity region	1597	1614	N/A	INTRINSIC
low complexity region	1631	1648	N/A	INTRINSIC
low complexity region	1738	1755	N/A	INTRINSIC
low complexity region	1767	1788	N/A	INTRINSIC
Blast:AKAP_110	1790	1883	2e-8	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000123853
AA Change: T733A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000116015
Gene: ENSMUSG00000022016
AA Change: T733A

Domain	Start	End	E-Value	Type
low complexity region	108	121	N/A	INTRINSIC
low complexity region	170	179	N/A	INTRINSIC
low complexity region	265	275	N/A	INTRINSIC
low complexity region	302	318	N/A	INTRINSIC
low complexity region	344	365	N/A	INTRINSIC
low complexity region	528	539	N/A	INTRINSIC
low complexity region	609	623	N/A	INTRINSIC
low complexity region	727	741	N/A	INTRINSIC
low complexity region	1161	1173	N/A	INTRINSIC
low complexity region	1597	1614	N/A	INTRINSIC
low complexity region	1631	1648	N/A	INTRINSIC
low complexity region	1731	1756	N/A	INTRINSIC
low complexity region	1768	1789	N/A	INTRINSIC
Blast:AKAP_110	1791	1884	2e-8	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000226416

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000227722

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.7%
20x: 93.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The A-kinase anchor proteins (AKAPs) are a group of structurally diverse proteins, which have the common function of binding to the regulatory subunit of protein kinase A (PKA) and confining the holoenzyme to discrete locations within the cell. This gene encodes a member of the AKAP family. The encoded protein is expressed at high levels throughout spermatogenesis and in mature sperm. It binds the RI and RII subunits of PKA in testis. It may serve a function in cell cycle control of both somatic cells and germ cells in addition to its putative role in spermatogenesis and sperm function. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show a reduction in body size, body length and tibia length, hypoactivity, slow movement and increased anxiety-related responses, and exhibit actin barrier defects in kidney collecting duct cells and increased urine osmolality in response to overhydration. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Antxrl	A	G	14: 34,073,042	N476D	possibly damaging	Het
Armc8	G	T	9: 99,523,248	P268Q	probably benign	Het
Asb8	C	A	15: 98,136,423	G84C	probably damaging	Het
BC027072	T	C	17: 71,749,161	N1174D	probably benign	Het
BC035044	A	T	6: 128,885,084		probably null	Het
Caprin1	A	G	2: 103,775,987	F303L	probably benign	Het
Cdh7	G	A	1: 110,061,132	V255I	probably benign	Het
Ctdspl2	G	A	2: 122,006,868	R371Q	probably damaging	Het
Dctn4	T	A	18: 60,556,330	D431E	probably benign	Het
Dhx40	T	C	11: 86,797,745	E284G	probably benign	Het
Dhx9	A	G	1: 153,464,938	V652A	probably damaging	Het
Fnip2	G	T	3: 79,508,091	N213K	possibly damaging	Het
Itch	A	G	2: 155,206,354	E546G	possibly damaging	Het
Map3k20	A	T	2: 72,389,494	I257F	probably damaging	Het
Mdc1	C	T	17: 35,853,532	T1324I	probably benign	Het
Mertk	T	C	2: 128,771,486	I474T	probably benign	Het
Nav3	A	G	10: 109,883,634	V156A	possibly damaging	Het
Nbea	A	G	3: 56,037,281	V554A	probably benign	Het
Olfr1308	A	G	2: 111,960,581	V164A	probably benign	Het
Olfr157	C	T	4: 43,835,582	V303M	possibly damaging	Het
Olfr419	T	A	1: 174,250,861	E22V	possibly damaging	Het
Pask	A	G	1: 93,321,651	Y676H	probably benign	Het
Plpp2	G	A	10: 79,530,777		probably benign	Het
Rab32	A	G	10: 10,550,893	V103A	probably damaging	Het
Rp1	T	C	1: 4,351,921	E262G	possibly damaging	Het
Rtn4	A	G	11: 29,708,236	T797A	probably benign	Het
Sall1	A	T	8: 89,032,444	I344K	probably benign	Het
Scnn1b	T	C	7: 121,902,544		probably null	Het
Sik3	G	T	9: 46,123,345		probably benign	Het
Slc7a2	G	T	8: 40,905,585	G322W	probably damaging	Het
Snx29	A	G	16: 11,399,793	M153V	probably benign	Het
Stk25	A	G	1: 93,625,153		probably benign	Het
Stk4	C	T	2: 164,100,528	T360M	probably benign	Het
Ush1c	A	C	7: 46,225,541		probably null	Het
Vmn2r8	C	T	5: 108,802,368	M204I	probably benign	Het
Zfp839	C	T	12: 110,866,310	T554M	probably damaging	Het

Other mutations in Akap11

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00672:Akap11	APN	14	78511341	missense	probably damaging	1.00
IGL00902:Akap11	APN	14	78495838	missense	probably benign	0.11
IGL01752:Akap11	APN	14	78509878	critical splice donor site	probably null
IGL01972:Akap11	APN	14	78507857	missense	probably damaging	0.99
IGL02031:Akap11	APN	14	78513813	missense	possibly damaging	0.50
IGL02239:Akap11	APN	14	78513849	missense	probably damaging	1.00
IGL02528:Akap11	APN	14	78510867	missense	probably damaging	1.00
IGL02884:Akap11	APN	14	78498962	missense	probably benign	0.02
IGL03130:Akap11	APN	14	78510368	nonsense	probably null
IGL03179:Akap11	APN	14	78507740	missense	probably benign	0.00
IGL03240:Akap11	APN	14	78495905	missense	probably damaging	0.99
IGL03331:Akap11	APN	14	78513865	missense	probably damaging	1.00
bonham	UTSW	14	78498864	nonsense	probably null
R0004:Akap11	UTSW	14	78514940	missense	possibly damaging	0.65
R0020:Akap11	UTSW	14	78518177	missense	probably benign	0.37
R0200:Akap11	UTSW	14	78510753	missense	probably benign	0.00
R0281:Akap11	UTSW	14	78510089	missense	possibly damaging	0.84
R0320:Akap11	UTSW	14	78513379	missense	probably benign
R0381:Akap11	UTSW	14	78513550	missense	probably benign	0.01
R0536:Akap11	UTSW	14	78514024	missense	probably damaging	1.00
R0608:Akap11	UTSW	14	78510753	missense	probably benign	0.00
R0735:Akap11	UTSW	14	78510078	missense	probably damaging	1.00
R1189:Akap11	UTSW	14	78513347	missense	probably benign	0.11
R1400:Akap11	UTSW	14	78513962	missense	probably damaging	1.00
R1406:Akap11	UTSW	14	78512749	missense	probably benign
R1501:Akap11	UTSW	14	78513347	missense	probably benign	0.11
R1588:Akap11	UTSW	14	78510245	missense	possibly damaging	0.50
R1717:Akap11	UTSW	14	78513348	missense	probably benign	0.02
R1823:Akap11	UTSW	14	78511488	missense	probably damaging	1.00
R1847:Akap11	UTSW	14	78513661	missense	probably benign	0.00
R1874:Akap11	UTSW	14	78511866	missense	probably benign	0.14
R2031:Akap11	UTSW	14	78510037	missense	possibly damaging	0.86
R2032:Akap11	UTSW	14	78510037	missense	possibly damaging	0.86
R2276:Akap11	UTSW	14	78510037	missense	possibly damaging	0.86
R2763:Akap11	UTSW	14	78518892	missense	probably damaging	0.98
R4483:Akap11	UTSW	14	78510259	missense	probably damaging	1.00
R4582:Akap11	UTSW	14	78511929	missense	possibly damaging	0.81
R4857:Akap11	UTSW	14	78498860	missense
R4922:Akap11	UTSW	14	78512780	nonsense	probably null
R4993:Akap11	UTSW	14	78512968	missense	probably damaging	1.00
R5426:Akap11	UTSW	14	78498864	nonsense	probably null
R5472:Akap11	UTSW	14	78513429	missense	probably benign	0.03
R5683:Akap11	UTSW	14	78512578	missense	probably damaging	0.98
R5774:Akap11	UTSW	14	78510967	missense	probably damaging	1.00
R6014:Akap11	UTSW	14	78512499	missense	probably benign	0.00
R6264:Akap11	UTSW	14	78512421	missense	possibly damaging	0.68
R6270:Akap11	UTSW	14	78518799	missense	probably damaging	1.00
R6319:Akap11	UTSW	14	78513538	missense	probably benign	0.06
R6376:Akap11	UTSW	14	78514896	missense	probably damaging	1.00
R6394:Akap11	UTSW	14	78522589	critical splice donor site	probably null
R6536:Akap11	UTSW	14	78511314	missense	possibly damaging	0.81
R7048:Akap11	UTSW	14	78512514	missense
R7147:Akap11	UTSW	14	78511465	missense
R7473:Akap11	UTSW	14	78513888	missense
R7503:Akap11	UTSW	14	78512001	missense
R7542:Akap11	UTSW	14	78510292	missense
R7618:Akap11	UTSW	14	78498860	missense
R7679:Akap11	UTSW	14	78514816	missense
R7973:Akap11	UTSW	14	78515066	missense
R8094:Akap11	UTSW	14	78512973	missense
R8098:Akap11	UTSW	14	78512922	missense
R8226:Akap11	UTSW	14	78511209	missense
R8269:Akap11	UTSW	14	78513378	missense
R8304:Akap11	UTSW	14	78513232	missense
R8343:Akap11	UTSW	14	78512489	missense
R8389:Akap11	UTSW	14	78518882	missense
R8824:Akap11	UTSW	14	78516347	missense
R9034:Akap11	UTSW	14	78510859	missense
R9189:Akap11	UTSW	14	78513498	missense
R9259:Akap11	UTSW	14	78512509	missense
R9275:Akap11	UTSW	14	78513709	missense
R9434:Akap11	UTSW	14	78510389	missense
R9500:Akap11	UTSW	14	78511103	missense

Predicted Primers

PCR Primer
(F):5'- GTTCTTGGGTAGAGCCACCACTTG -3'
(R):5'- CACCTGCATCTTCACAGTGTCAGTC -3'

Sequencing Primer
(F):5'- GCTTTACTAGGCTCAGATGAAAGAC -3'
(R):5'- CACAGTGTCAGTCATTTGACTTTG -3'

Posted On

2014-05-09