Mutagenetix > Incidental Mutation

Incidental Mutation 'R1652:Atp1a4'

188760

Institutional Source

Beutler Lab

Gene Symbol

Atp1a4

Ensembl Gene

ENSMUSG00000007107

Gene Name

ATPase, Na+/K+ transporting, alpha 4 polypeptide

Synonyms

MMRRC Submission

039688-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1652 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

172223513-172258414 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 172254903 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 124 (Y124C)

Ref Sequence

ENSEMBL: ENSMUSP00000106874 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000111243]

AlphaFold

Q9WV27

Predicted Effect

probably damaging
Transcript: ENSMUST00000111243
AA Change: Y124C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000106874
Gene: ENSMUSG00000007107
AA Change: Y124C

Domain	Start	End	E-Value	Type
low complexity region	33	50	N/A	INTRINSIC
Cation_ATPase_N	51	125	1.22e-14	SMART
Pfam:E1-E2_ATPase	144	375	2.6e-59	PFAM
Pfam:Hydrolase	380	738	8.1e-19	PFAM
Pfam:HAD	383	735	1.6e-17	PFAM
Pfam:Cation_ATPase	437	531	9.2e-25	PFAM
Pfam:Cation_ATPase_C	808	1017	1.2e-47	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193316

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type cation transport ATPases, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The catalytic subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes an alpha 4 subunit. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a knock-out allele exhibit infertility associated with asthenozoospermia and teratozoospermia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	T	15: 8,201,146	R969L	probably damaging	Het
Adam2	T	A	14: 66,077,251	E37V	probably benign	Het
Adamts7	A	G	9: 90,189,644	D664G	probably damaging	Het
Adamtsl5	A	G	10: 80,342,177	V256A	probably benign	Het
Adrb1	C	T	19: 56,723,273	S301L	possibly damaging	Het
Akap9	A	G	5: 4,077,210	Y3686C	probably damaging	Het
Ap3b2	A	G	7: 81,473,399	S456P	probably damaging	Het
Bdkrb1	A	T	12: 105,604,243	T23S	probably damaging	Het
Cacna1g	A	G	11: 94,427,404	Y1468H	probably damaging	Het
Cep170b	A	G	12: 112,733,513	D152G	probably damaging	Het
Cers4	T	A	8: 4,516,908		probably null	Het
Cyp2t4	A	T	7: 27,157,390	D285V	possibly damaging	Het
Ddx56	A	T	11: 6,267,679	L14Q	probably damaging	Het
Dennd2d	C	A	3: 106,487,001	R63S	probably benign	Het
Dnah7b	T	A	1: 46,175,390	L1105*	probably null	Het
Eef1e1	A	T	13: 38,656,105	L75I	possibly damaging	Het
Fam76b	A	G	9: 13,835,892	S191G	probably benign	Het
Fat1	T	A	8: 45,025,178	Y2420*	probably null	Het
Fbxw18	T	A	9: 109,690,627	L270F	probably benign	Het
Fech	T	A	18: 64,458,198	H385L	probably benign	Het
Fkbp4	A	T	6: 128,436,674	I2N	probably damaging	Het
Gda	A	T	19: 21,400,678	M339K	probably damaging	Het
Gdpgp1	T	A	7: 80,239,364	M381K	probably benign	Het
Glyctk	C	A	9: 106,157,157	V173L	probably damaging	Het
Gm2056	T	A	12: 88,027,083	V27E	probably benign	Het
Gtf2ird1	G	A	5: 134,395,713	P393L	probably damaging	Het
Kat2a	T	C	11: 100,708,611	N517D	probably damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lama1	G	A	17: 67,807,846	R2330Q	probably damaging	Het
Lamc1	C	T	1: 153,249,646	G597E	probably damaging	Het
Lekr1	A	T	3: 65,684,087	S82C	probably benign	Het
Lgi3	T	C	14: 70,531,216	F51S	probably damaging	Het
Lrba	T	C	3: 86,539,938	S2030P	probably damaging	Het
Map4k5	A	G	12: 69,830,427		probably null	Het
Mcoln2	C	A	3: 146,163,635	R32S	possibly damaging	Het
Metap1	A	T	3: 138,462,390	F324L	probably damaging	Het
Moxd2	C	T	6: 40,887,403	R31H	probably damaging	Het
Ncf4	T	A	15: 78,261,034	M274K	possibly damaging	Het
Nup205	T	G	6: 35,238,966	V1747G	probably benign	Het
Olfr290	T	C	7: 84,916,520	V247A	probably damaging	Het
Olfr584	A	G	7: 103,085,806	D91G	probably benign	Het
Olfr958	G	A	9: 39,550,295	T192I	probably benign	Het
Pbx3	C	T	2: 34,224,556	G122D	probably damaging	Het
Plcb3	A	G	19: 6,955,296	F1034L	probably benign	Het
Ppp2r1a	G	A	17: 20,955,974	V153I	probably benign	Het
Prss33	C	G	17: 23,835,141	M30I	probably benign	Het
Prss33	A	T	17: 23,835,142	M30K	probably benign	Het
R3hdm2	G	A	10: 127,495,091	S793N	probably benign	Het
Rab11fip5	C	T	6: 85,348,297	V343M	probably damaging	Het
Rere	A	G	4: 150,612,065		probably benign	Het
Rims1	G	T	1: 22,292,866	P52Q	probably damaging	Het
Scpep1	G	T	11: 88,952,434	S66*	probably null	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Shc3	A	T	13: 51,472,839	H129Q	probably damaging	Het
Slc22a20	A	T	19: 5,972,942	M391K	probably damaging	Het
Smurf1	A	T	5: 144,880,664	I712K	probably damaging	Het
Snx25	T	A	8: 46,049,473	I629L	probably damaging	Het
Supt16	A	C	14: 52,177,180	V425G	probably benign	Het
Tnik	G	A	3: 28,604,293	V576I	probably benign	Het
Trcg1	A	C	9: 57,245,573	D551A	probably damaging	Het
Ubald2	A	G	11: 116,434,352	N15S	probably damaging	Het
Usf1	T	C	1: 171,417,749	I243T	probably damaging	Het
Vmn2r19	A	T	6: 123,315,697	I233F	possibly damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wdr27	A	G	17: 14,917,270	F419L	probably benign	Het

Other mutations in Atp1a4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00419:Atp1a4	APN	1	172239806	missense	probably damaging	1.00
IGL00924:Atp1a4	APN	1	172246772	missense	probably damaging	1.00
IGL01288:Atp1a4	APN	1	172257907	missense	possibly damaging	0.77
IGL01665:Atp1a4	APN	1	172246724	missense	probably benign
IGL02156:Atp1a4	APN	1	172257962	missense	probably benign
IGL02170:Atp1a4	APN	1	172234536	missense	possibly damaging	0.94
IGL02228:Atp1a4	APN	1	172254885	missense	possibly damaging	0.69
IGL02505:Atp1a4	APN	1	172235075	missense	probably damaging	1.00
IGL02653:Atp1a4	APN	1	172251406	missense	possibly damaging	0.81
IGL02792:Atp1a4	APN	1	172227299	critical splice donor site	probably null
IGL02794:Atp1a4	APN	1	172244086	missense	probably benign	0.13
IGL03102:Atp1a4	APN	1	172231151	missense	probably damaging	1.00
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0046:Atp1a4	UTSW	1	172240097	missense	probably benign	0.09
R0276:Atp1a4	UTSW	1	172257901	missense	probably damaging	1.00
R0309:Atp1a4	UTSW	1	172234987	missense	probably damaging	1.00
R0525:Atp1a4	UTSW	1	172239688	splice site	probably benign
R0615:Atp1a4	UTSW	1	172232060	splice site	probably benign
R0730:Atp1a4	UTSW	1	172240207	splice site	probably benign
R1412:Atp1a4	UTSW	1	172232009	missense	probably damaging	0.97
R1898:Atp1a4	UTSW	1	172235048	missense	probably damaging	0.99
R1968:Atp1a4	UTSW	1	172240164	missense	probably benign
R2291:Atp1a4	UTSW	1	172244906	missense	probably damaging	1.00
R2897:Atp1a4	UTSW	1	172246690	missense	probably damaging	1.00
R2908:Atp1a4	UTSW	1	172234477	missense	probably benign
R3119:Atp1a4	UTSW	1	172239826	missense	probably damaging	0.99
R3731:Atp1a4	UTSW	1	172233961	missense	probably damaging	1.00
R4447:Atp1a4	UTSW	1	172234431	missense	probably damaging	0.99
R4602:Atp1a4	UTSW	1	172239765	missense	probably damaging	1.00
R4670:Atp1a4	UTSW	1	172235000	missense	probably benign	0.07
R4674:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4675:Atp1a4	UTSW	1	172257656	missense	possibly damaging	0.81
R4785:Atp1a4	UTSW	1	172254110	nonsense	probably null
R4958:Atp1a4	UTSW	1	172231151	missense	probably damaging	1.00
R5015:Atp1a4	UTSW	1	172254082	missense	probably damaging	1.00
R5149:Atp1a4	UTSW	1	172232005	missense	probably damaging	1.00
R5234:Atp1a4	UTSW	1	172227170	missense	possibly damaging	0.73
R5501:Atp1a4	UTSW	1	172246832	missense	probably damaging	1.00
R5682:Atp1a4	UTSW	1	172254163	missense	probably damaging	0.99
R5872:Atp1a4	UTSW	1	172244408	missense	probably damaging	1.00
R5933:Atp1a4	UTSW	1	172232274	missense	possibly damaging	0.91
R6722:Atp1a4	UTSW	1	172258050	unclassified	probably benign
R7087:Atp1a4	UTSW	1	172246702	missense	probably damaging	1.00
R7122:Atp1a4	UTSW	1	172231936	missense	possibly damaging	0.47
R7381:Atp1a4	UTSW	1	172240115	missense	possibly damaging	0.70
R7431:Atp1a4	UTSW	1	172250907	missense	probably benign	0.31
R8269:Atp1a4	UTSW	1	172232325	missense	probably damaging	1.00
R8400:Atp1a4	UTSW	1	172234494	missense	probably damaging	1.00
R8559:Atp1a4	UTSW	1	172251330	missense	probably damaging	1.00
R8680:Atp1a4	UTSW	1	172250999	missense	probably damaging	1.00
R8777:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8777-TAIL:Atp1a4	UTSW	1	172232302	missense	probably damaging	1.00
R8867:Atp1a4	UTSW	1	172244924	missense	probably damaging	0.99
R8869:Atp1a4	UTSW	1	172227123	missense	probably benign
R9260:Atp1a4	UTSW	1	172246792	missense	probably damaging	1.00
R9300:Atp1a4	UTSW	1	172239831	missense	probably damaging	1.00
R9545:Atp1a4	UTSW	1	172250897	missense	probably benign	0.35
Z1176:Atp1a4	UTSW	1	172231954	missense	probably benign	0.44

Predicted Primers

PCR Primer
(F):5'- GCGAGTAGACTGGTAGAATAACGCC -3'
(R):5'- GTTGTCATGCCATCTCAGAGTCCC -3'

Sequencing Primer
(F):5'- ACGCCTTTTAGGGAGCTAAAC -3'
(R):5'- tgatgatattctcagctcctacc -3'

Posted On

2014-05-09