Incidental Mutation 'R1652:Pbx3'
ID188761
Institutional Source Beutler Lab
Gene Symbol Pbx3
Ensembl Gene ENSMUSG00000038718
Gene Namepre B cell leukemia homeobox 3
Synonyms
MMRRC Submission 039688-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1652 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location34171457-34373142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 34224556 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 122 (G122D)
Ref Sequence ENSEMBL: ENSMUSP00000108757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040638] [ENSMUST00000113132] [ENSMUST00000127353] [ENSMUST00000138021] [ENSMUST00000141653] [ENSMUST00000143776] [ENSMUST00000153278]
Predicted Effect probably damaging
Transcript: ENSMUST00000040638
AA Change: G122D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000045281
Gene: ENSMUSG00000038718
AA Change: G122D

DomainStartEndE-ValueType
Pfam:PBC 43 234 2.7e-97 PFAM
HOX 235 300 1.74e-17 SMART
low complexity region 308 341 N/A INTRINSIC
Blast:HOX 342 385 1e-21 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113132
AA Change: G122D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108757
Gene: ENSMUSG00000038718
AA Change: G122D

DomainStartEndE-ValueType
Pfam:PBC 38 234 8.5e-103 PFAM
HOX 235 300 8.8e-20 SMART
low complexity region 308 336 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000127353
AA Change: G47D

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114695
Gene: ENSMUSG00000038718
AA Change: G47D

DomainStartEndE-ValueType
Pfam:PBC 1 54 2e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000138021
AA Change: G64D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000135226
Gene: ENSMUSG00000038718
AA Change: G64D

DomainStartEndE-ValueType
Pfam:PBC 3 128 3.7e-60 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141653
AA Change: G47D

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000115710
Gene: ENSMUSG00000038718
AA Change: G47D

DomainStartEndE-ValueType
Pfam:PBC 1 96 6.7e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000143776
SMART Domains Protein: ENSMUSP00000119914
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153278
SMART Domains Protein: ENSMUSP00000123567
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 38 93 4.9e-26 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000175855
AA Change: G38D
SMART Domains Protein: ENSMUSP00000135838
Gene: ENSMUSG00000038718
AA Change: G38D

DomainStartEndE-ValueType
Pfam:PBC 1 53 1.6e-27 PFAM
HOX 54 119 8.8e-20 SMART
low complexity region 127 155 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176213
SMART Domains Protein: ENSMUSP00000135702
Gene: ENSMUSG00000038718

DomainStartEndE-ValueType
Pfam:PBC 2 145 3.2e-76 PFAM
HOX 146 211 1.74e-17 SMART
low complexity region 219 247 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous null mice display neonatal lethality with hypoventilation and respiratory failure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,201,146 R969L probably damaging Het
Adam2 T A 14: 66,077,251 E37V probably benign Het
Adamts7 A G 9: 90,189,644 D664G probably damaging Het
Adamtsl5 A G 10: 80,342,177 V256A probably benign Het
Adrb1 C T 19: 56,723,273 S301L possibly damaging Het
Akap9 A G 5: 4,077,210 Y3686C probably damaging Het
Ap3b2 A G 7: 81,473,399 S456P probably damaging Het
Atp1a4 T C 1: 172,254,903 Y124C probably damaging Het
Bdkrb1 A T 12: 105,604,243 T23S probably damaging Het
Cacna1g A G 11: 94,427,404 Y1468H probably damaging Het
Cep170b A G 12: 112,733,513 D152G probably damaging Het
Cers4 T A 8: 4,516,908 probably null Het
Cyp2t4 A T 7: 27,157,390 D285V possibly damaging Het
Ddx56 A T 11: 6,267,679 L14Q probably damaging Het
Dennd2d C A 3: 106,487,001 R63S probably benign Het
Dnah7b T A 1: 46,175,390 L1105* probably null Het
Eef1e1 A T 13: 38,656,105 L75I possibly damaging Het
Fam76b A G 9: 13,835,892 S191G probably benign Het
Fat1 T A 8: 45,025,178 Y2420* probably null Het
Fbxw18 T A 9: 109,690,627 L270F probably benign Het
Fech T A 18: 64,458,198 H385L probably benign Het
Fkbp4 A T 6: 128,436,674 I2N probably damaging Het
Gda A T 19: 21,400,678 M339K probably damaging Het
Gdpgp1 T A 7: 80,239,364 M381K probably benign Het
Glyctk C A 9: 106,157,157 V173L probably damaging Het
Gm2056 T A 12: 88,027,083 V27E probably benign Het
Gtf2ird1 G A 5: 134,395,713 P393L probably damaging Het
Kat2a T C 11: 100,708,611 N517D probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama1 G A 17: 67,807,846 R2330Q probably damaging Het
Lamc1 C T 1: 153,249,646 G597E probably damaging Het
Lekr1 A T 3: 65,684,087 S82C probably benign Het
Lgi3 T C 14: 70,531,216 F51S probably damaging Het
Lrba T C 3: 86,539,938 S2030P probably damaging Het
Map4k5 A G 12: 69,830,427 probably null Het
Mcoln2 C A 3: 146,163,635 R32S possibly damaging Het
Metap1 A T 3: 138,462,390 F324L probably damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Ncf4 T A 15: 78,261,034 M274K possibly damaging Het
Nup205 T G 6: 35,238,966 V1747G probably benign Het
Olfr290 T C 7: 84,916,520 V247A probably damaging Het
Olfr584 A G 7: 103,085,806 D91G probably benign Het
Olfr958 G A 9: 39,550,295 T192I probably benign Het
Plcb3 A G 19: 6,955,296 F1034L probably benign Het
Ppp2r1a G A 17: 20,955,974 V153I probably benign Het
Prss33 C G 17: 23,835,141 M30I probably benign Het
Prss33 A T 17: 23,835,142 M30K probably benign Het
R3hdm2 G A 10: 127,495,091 S793N probably benign Het
Rab11fip5 C T 6: 85,348,297 V343M probably damaging Het
Rere A G 4: 150,612,065 probably benign Het
Rims1 G T 1: 22,292,866 P52Q probably damaging Het
Scpep1 G T 11: 88,952,434 S66* probably null Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc3 A T 13: 51,472,839 H129Q probably damaging Het
Slc22a20 A T 19: 5,972,942 M391K probably damaging Het
Smurf1 A T 5: 144,880,664 I712K probably damaging Het
Snx25 T A 8: 46,049,473 I629L probably damaging Het
Supt16 A C 14: 52,177,180 V425G probably benign Het
Tnik G A 3: 28,604,293 V576I probably benign Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Ubald2 A G 11: 116,434,352 N15S probably damaging Het
Usf1 T C 1: 171,417,749 I243T probably damaging Het
Vmn2r19 A T 6: 123,315,697 I233F possibly damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wdr27 A G 17: 14,917,270 F419L probably benign Het
Other mutations in Pbx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02468:Pbx3 APN 2 34224577 missense probably damaging 1.00
IGL02524:Pbx3 APN 2 34370818 splice site probably benign
PIT4812001:Pbx3 UTSW 2 34224619 missense probably damaging 0.96
R0302:Pbx3 UTSW 2 34224560 missense probably benign 0.42
R1526:Pbx3 UTSW 2 34371764 missense probably damaging 1.00
R1529:Pbx3 UTSW 2 34204859 missense probably damaging 1.00
R1627:Pbx3 UTSW 2 34175953 missense probably benign 0.00
R1791:Pbx3 UTSW 2 34224452 missense possibly damaging 0.95
R1850:Pbx3 UTSW 2 34176820 missense probably benign 0.34
R2908:Pbx3 UTSW 2 34172921 missense probably damaging 0.96
R4073:Pbx3 UTSW 2 34224412 missense probably damaging 1.00
R5212:Pbx3 UTSW 2 34288781 intron probably benign
R5897:Pbx3 UTSW 2 34371908 missense probably benign 0.01
R7376:Pbx3 UTSW 2 34204877 missense probably damaging 0.96
R7504:Pbx3 UTSW 2 34175924 missense probably damaging 0.99
R7812:Pbx3 UTSW 2 34224466 missense probably damaging 1.00
R8079:Pbx3 UTSW 2 34178228 missense probably benign 0.36
Predicted Primers PCR Primer
(F):5'- CCCTTTTATGAACAAAGCCAGTGCC -3'
(R):5'- AATGTGAGCCGTGAAGCTCTCAG -3'

Sequencing Primer
(F):5'- TTCTTCAGGGCACCAAGTGAG -3'
(R):5'- CTCTCAGCATGAGTTGTAGTACAC -3'
Posted On2014-05-09