Incidental Mutation 'R1652:Ap3b2'
ID 188783
Institutional Source Beutler Lab
Gene Symbol Ap3b2
Ensembl Gene ENSMUSG00000062444
Gene Name adaptor-related protein complex 3, beta 2 subunit
Synonyms Naptb, beta3B
MMRRC Submission 039688-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.105) question?
Stock # R1652 (G1)
Quality Score 132
Status Not validated
Chromosome 7
Chromosomal Location 81110147-81143673 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 81123147 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 456 (S456P)
Ref Sequence ENSEMBL: ENSMUSP00000080739 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]
AlphaFold Q9JME5
Predicted Effect probably damaging
Transcript: ENSMUST00000082090
AA Change: S456P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: S456P

DomainStartEndE-ValueType
Pfam:Adaptin_N 34 590 8.2e-182 PFAM
low complexity region 689 782 N/A INTRINSIC
AP3B1_C 801 947 4.58e-75 SMART
Blast:B2 971 1080 2e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125634
Predicted Effect probably benign
Transcript: ENSMUST00000152355
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam2 T A 14: 66,314,700 (GRCm39) E37V probably benign Het
Adamts7 A G 9: 90,071,697 (GRCm39) D664G probably damaging Het
Adamtsl5 A G 10: 80,178,011 (GRCm39) V256A probably benign Het
Adrb1 C T 19: 56,711,705 (GRCm39) S301L possibly damaging Het
Akap9 A G 5: 4,127,210 (GRCm39) Y3686C probably damaging Het
Atp1a4 T C 1: 172,082,470 (GRCm39) Y124C probably damaging Het
Bdkrb1 A T 12: 105,570,502 (GRCm39) T23S probably damaging Het
Cacna1g A G 11: 94,318,230 (GRCm39) Y1468H probably damaging Het
Cep170b A G 12: 112,699,947 (GRCm39) D152G probably damaging Het
Cers4 T A 8: 4,566,908 (GRCm39) probably null Het
Cplane1 G T 15: 8,230,630 (GRCm39) R969L probably damaging Het
Cyp2t4 A T 7: 26,856,815 (GRCm39) D285V possibly damaging Het
Ddx56 A T 11: 6,217,679 (GRCm39) L14Q probably damaging Het
Dennd2d C A 3: 106,394,317 (GRCm39) R63S probably benign Het
Dnah7b T A 1: 46,214,550 (GRCm39) L1105* probably null Het
Eef1e1 A T 13: 38,840,081 (GRCm39) L75I possibly damaging Het
Eif1ad11 T A 12: 87,993,853 (GRCm39) V27E probably benign Het
Fam76b A G 9: 13,747,188 (GRCm39) S191G probably benign Het
Fat1 T A 8: 45,478,215 (GRCm39) Y2420* probably null Het
Fbxw18 T A 9: 109,519,695 (GRCm39) L270F probably benign Het
Fech T A 18: 64,591,269 (GRCm39) H385L probably benign Het
Fkbp4 A T 6: 128,413,637 (GRCm39) I2N probably damaging Het
Gda A T 19: 21,378,042 (GRCm39) M339K probably damaging Het
Gdpgp1 T A 7: 79,889,112 (GRCm39) M381K probably benign Het
Glyctk C A 9: 106,034,356 (GRCm39) V173L probably damaging Het
Gtf2ird1 G A 5: 134,424,567 (GRCm39) P393L probably damaging Het
Kat2a T C 11: 100,599,437 (GRCm39) N517D probably damaging Het
Krt84 G A 15: 101,434,398 (GRCm39) S523F possibly damaging Het
Lama1 G A 17: 68,114,841 (GRCm39) R2330Q probably damaging Het
Lamc1 C T 1: 153,125,392 (GRCm39) G597E probably damaging Het
Lekr1 A T 3: 65,591,508 (GRCm39) S82C probably benign Het
Lgi3 T C 14: 70,768,656 (GRCm39) F51S probably damaging Het
Lrba T C 3: 86,447,245 (GRCm39) S2030P probably damaging Het
Map4k5 A G 12: 69,877,201 (GRCm39) probably null Het
Mcoln2 C A 3: 145,869,390 (GRCm39) R32S possibly damaging Het
Metap1 A T 3: 138,168,151 (GRCm39) F324L probably damaging Het
Moxd2 C T 6: 40,864,337 (GRCm39) R31H probably damaging Het
Ncf4 T A 15: 78,145,234 (GRCm39) M274K possibly damaging Het
Nup205 T G 6: 35,215,901 (GRCm39) V1747G probably benign Het
Or10d3 G A 9: 39,461,591 (GRCm39) T192I probably benign Het
Or52r1c A G 7: 102,735,013 (GRCm39) D91G probably benign Het
Or5ae1 T C 7: 84,565,728 (GRCm39) V247A probably damaging Het
Pbx3 C T 2: 34,114,568 (GRCm39) G122D probably damaging Het
Plcb3 A G 19: 6,932,664 (GRCm39) F1034L probably benign Het
Ppp2r1a G A 17: 21,176,236 (GRCm39) V153I probably benign Het
Prss33 C G 17: 24,054,115 (GRCm39) M30I probably benign Het
Prss33 A T 17: 24,054,116 (GRCm39) M30K probably benign Het
R3hdm2 G A 10: 127,330,960 (GRCm39) S793N probably benign Het
Rab11fip5 C T 6: 85,325,279 (GRCm39) V343M probably damaging Het
Rere A G 4: 150,696,522 (GRCm39) probably benign Het
Rims1 G T 1: 22,363,090 (GRCm39) P52Q probably damaging Het
Scpep1 G T 11: 88,843,260 (GRCm39) S66* probably null Het
Setd2 A G 9: 110,378,932 (GRCm39) S632G probably benign Het
Shc3 A T 13: 51,626,875 (GRCm39) H129Q probably damaging Het
Slc22a20 A T 19: 6,022,970 (GRCm39) M391K probably damaging Het
Smurf1 A T 5: 144,817,474 (GRCm39) I712K probably damaging Het
Snx25 T A 8: 46,502,510 (GRCm39) I629L probably damaging Het
Supt16 A C 14: 52,414,637 (GRCm39) V425G probably benign Het
Tnik G A 3: 28,658,442 (GRCm39) V576I probably benign Het
Trcg1 A C 9: 57,152,856 (GRCm39) D551A probably damaging Het
Ubald2 A G 11: 116,325,178 (GRCm39) N15S probably damaging Het
Usf1 T C 1: 171,245,317 (GRCm39) I243T probably damaging Het
Vmn2r19 A T 6: 123,292,656 (GRCm39) I233F possibly damaging Het
Vmn2r63 T C 7: 42,577,635 (GRCm39) N301S probably benign Het
Wdr27 A G 17: 15,137,532 (GRCm39) F419L probably benign Het
Other mutations in Ap3b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00772:Ap3b2 APN 7 81,121,697 (GRCm39) missense probably damaging 0.98
IGL01695:Ap3b2 APN 7 81,126,687 (GRCm39) splice site probably benign
IGL01876:Ap3b2 APN 7 81,123,602 (GRCm39) splice site probably null
IGL02132:Ap3b2 APN 7 81,110,746 (GRCm39) missense unknown
IGL02227:Ap3b2 APN 7 81,123,152 (GRCm39) missense probably damaging 1.00
IGL02660:Ap3b2 APN 7 81,115,446 (GRCm39) missense probably benign 0.13
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0045:Ap3b2 UTSW 7 81,115,941 (GRCm39) missense possibly damaging 0.82
R0142:Ap3b2 UTSW 7 81,122,828 (GRCm39) missense probably damaging 0.96
R0317:Ap3b2 UTSW 7 81,113,429 (GRCm39) splice site probably null
R0568:Ap3b2 UTSW 7 81,114,377 (GRCm39) critical splice donor site probably null
R1035:Ap3b2 UTSW 7 81,113,659 (GRCm39) missense unknown
R1121:Ap3b2 UTSW 7 81,113,943 (GRCm39) missense unknown
R1160:Ap3b2 UTSW 7 81,115,917 (GRCm39) critical splice donor site probably null
R1489:Ap3b2 UTSW 7 81,113,438 (GRCm39) nonsense probably null
R1542:Ap3b2 UTSW 7 81,127,825 (GRCm39) splice site probably null
R1741:Ap3b2 UTSW 7 81,117,347 (GRCm39) missense possibly damaging 0.95
R1872:Ap3b2 UTSW 7 81,113,898 (GRCm39) missense unknown
R2065:Ap3b2 UTSW 7 81,113,522 (GRCm39) missense unknown
R2353:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2354:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R2398:Ap3b2 UTSW 7 81,126,943 (GRCm39) missense probably damaging 0.99
R3421:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3710:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3932:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R3933:Ap3b2 UTSW 7 81,123,598 (GRCm39) unclassified probably benign
R4152:Ap3b2 UTSW 7 81,127,765 (GRCm39) missense probably damaging 1.00
R4209:Ap3b2 UTSW 7 81,126,884 (GRCm39) missense probably benign 0.02
R4732:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4733:Ap3b2 UTSW 7 81,121,680 (GRCm39) missense probably damaging 1.00
R4841:Ap3b2 UTSW 7 81,127,678 (GRCm39) missense probably damaging 1.00
R5207:Ap3b2 UTSW 7 81,126,517 (GRCm39) missense possibly damaging 0.48
R5659:Ap3b2 UTSW 7 81,126,500 (GRCm39) missense probably damaging 0.98
R6109:Ap3b2 UTSW 7 81,143,340 (GRCm39) missense possibly damaging 0.55
R6223:Ap3b2 UTSW 7 81,123,210 (GRCm39) nonsense probably null
R6901:Ap3b2 UTSW 7 81,134,660 (GRCm39) critical splice acceptor site probably null
R6981:Ap3b2 UTSW 7 81,127,741 (GRCm39) missense probably damaging 1.00
R7061:Ap3b2 UTSW 7 81,110,757 (GRCm39) missense unknown
R7317:Ap3b2 UTSW 7 81,110,776 (GRCm39) missense unknown
R7501:Ap3b2 UTSW 7 81,123,194 (GRCm39) missense probably damaging 0.99
R7543:Ap3b2 UTSW 7 81,115,894 (GRCm39) splice site probably null
R7643:Ap3b2 UTSW 7 81,126,820 (GRCm39) missense probably benign 0.24
R7707:Ap3b2 UTSW 7 81,126,530 (GRCm39) missense possibly damaging 0.60
R8111:Ap3b2 UTSW 7 81,113,530 (GRCm39) missense unknown
R8273:Ap3b2 UTSW 7 81,112,990 (GRCm39) missense unknown
R8325:Ap3b2 UTSW 7 81,134,237 (GRCm39) splice site probably null
R8355:Ap3b2 UTSW 7 81,122,851 (GRCm39) missense probably damaging 1.00
R8697:Ap3b2 UTSW 7 81,122,783 (GRCm39) missense possibly damaging 0.91
R8716:Ap3b2 UTSW 7 81,126,901 (GRCm39) missense probably benign 0.03
R8923:Ap3b2 UTSW 7 81,126,931 (GRCm39) missense probably benign 0.08
R9002:Ap3b2 UTSW 7 81,117,192 (GRCm39) missense probably benign 0.02
R9163:Ap3b2 UTSW 7 81,113,546 (GRCm39) missense unknown
R9304:Ap3b2 UTSW 7 81,113,019 (GRCm39) missense unknown
R9321:Ap3b2 UTSW 7 81,114,252 (GRCm39) critical splice acceptor site probably null
R9413:Ap3b2 UTSW 7 81,127,757 (GRCm39) missense possibly damaging 0.45
R9459:Ap3b2 UTSW 7 81,123,651 (GRCm39) missense probably benign 0.16
R9746:Ap3b2 UTSW 7 81,126,092 (GRCm39) missense probably damaging 1.00
X0013:Ap3b2 UTSW 7 81,112,988 (GRCm39) critical splice donor site probably null
X0028:Ap3b2 UTSW 7 81,113,512 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGCACACTAACTGAAGCAGATAGCC -3'
(R):5'- TCCCTGTGCTCAGAGAGAATTTCCC -3'

Sequencing Primer
(F):5'- TAACTGAAGCAGATAGCCAACAG -3'
(R):5'- GCTCAGAGAGAATTTCCCTGATG -3'
Posted On 2014-05-09