Mutagenetix > Incidental Mutation

Incidental Mutation 'R1652:Ap3b2'

188783

Institutional Source

Beutler Lab

Gene Symbol

Ap3b2

Ensembl Gene

ENSMUSG00000062444

Gene Name

adaptor-related protein complex 3, beta 2 subunit

Synonyms

beta3B, Naptb

MMRRC Submission

039688-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.089) question?

Stock #

R1652 (G1)

Quality Score

132

Status

Not validated

Chromosome

Chromosomal Location

81460399-81493925 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 81473399 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 456 (S456P)

Ref Sequence

ENSEMBL: ENSMUSP00000080739 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000082090] [ENSMUST00000152355]

AlphaFold

Q9JME5

Predicted Effect

probably damaging
Transcript: ENSMUST00000082090
AA Change: S456P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000080739
Gene: ENSMUSG00000062444
AA Change: S456P

Domain	Start	End	E-Value	Type
Pfam:Adaptin_N	34	590	8.2e-182	PFAM
low complexity region	689	782	N/A	INTRINSIC
AP3B1_C	801	947	4.58e-75	SMART
Blast:B2	971	1080	2e-12	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125634

Predicted Effect

probably benign
Transcript: ENSMUST00000152355

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.2%
20x: 92.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adaptor protein complex 3 (AP-3 complex) is a heterotrimeric protein complex involved in the formation of clathrin-coated synaptic vesicles. The protein encoded by this gene represents the beta subunit of the neuron-specific AP-3 complex and was first identified as the target antigen in human paraneoplastic neurologic disorders. The encoded subunit binds clathrin and is phosphorylated by a casein kinase-like protein, which mediates synaptic vesicle coat assembly. Defects in this gene are a cause of early-onset epileptic encephalopathy. [provided by RefSeq, Feb 2017]
PHENOTYPE: Disruption does not alter pigmentation, but causes hyperactivity and tonic-clonic seizures and mice homozygous for a knock-out allele were found to have significantly reduced synaptic zinc levels throughout the brain, with the largest reduction observed in the CA1 stratum oriens. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 65 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2410089E03Rik	G	T	15: 8,201,146	R969L	probably damaging	Het
Adam2	T	A	14: 66,077,251	E37V	probably benign	Het
Adamts7	A	G	9: 90,189,644	D664G	probably damaging	Het
Adamtsl5	A	G	10: 80,342,177	V256A	probably benign	Het
Adrb1	C	T	19: 56,723,273	S301L	possibly damaging	Het
Akap9	A	G	5: 4,077,210	Y3686C	probably damaging	Het
Atp1a4	T	C	1: 172,254,903	Y124C	probably damaging	Het
Bdkrb1	A	T	12: 105,604,243	T23S	probably damaging	Het
Cacna1g	A	G	11: 94,427,404	Y1468H	probably damaging	Het
Cep170b	A	G	12: 112,733,513	D152G	probably damaging	Het
Cers4	T	A	8: 4,516,908		probably null	Het
Cyp2t4	A	T	7: 27,157,390	D285V	possibly damaging	Het
Ddx56	A	T	11: 6,267,679	L14Q	probably damaging	Het
Dennd2d	C	A	3: 106,487,001	R63S	probably benign	Het
Dnah7b	T	A	1: 46,175,390	L1105*	probably null	Het
Eef1e1	A	T	13: 38,656,105	L75I	possibly damaging	Het
Fam76b	A	G	9: 13,835,892	S191G	probably benign	Het
Fat1	T	A	8: 45,025,178	Y2420*	probably null	Het
Fbxw18	T	A	9: 109,690,627	L270F	probably benign	Het
Fech	T	A	18: 64,458,198	H385L	probably benign	Het
Fkbp4	A	T	6: 128,436,674	I2N	probably damaging	Het
Gda	A	T	19: 21,400,678	M339K	probably damaging	Het
Gdpgp1	T	A	7: 80,239,364	M381K	probably benign	Het
Glyctk	C	A	9: 106,157,157	V173L	probably damaging	Het
Gm2056	T	A	12: 88,027,083	V27E	probably benign	Het
Gtf2ird1	G	A	5: 134,395,713	P393L	probably damaging	Het
Kat2a	T	C	11: 100,708,611	N517D	probably damaging	Het
Krt84	G	A	15: 101,525,963	S523F	possibly damaging	Het
Lama1	G	A	17: 67,807,846	R2330Q	probably damaging	Het
Lamc1	C	T	1: 153,249,646	G597E	probably damaging	Het
Lekr1	A	T	3: 65,684,087	S82C	probably benign	Het
Lgi3	T	C	14: 70,531,216	F51S	probably damaging	Het
Lrba	T	C	3: 86,539,938	S2030P	probably damaging	Het
Map4k5	A	G	12: 69,830,427		probably null	Het
Mcoln2	C	A	3: 146,163,635	R32S	possibly damaging	Het
Metap1	A	T	3: 138,462,390	F324L	probably damaging	Het
Moxd2	C	T	6: 40,887,403	R31H	probably damaging	Het
Ncf4	T	A	15: 78,261,034	M274K	possibly damaging	Het
Nup205	T	G	6: 35,238,966	V1747G	probably benign	Het
Olfr290	T	C	7: 84,916,520	V247A	probably damaging	Het
Olfr584	A	G	7: 103,085,806	D91G	probably benign	Het
Olfr958	G	A	9: 39,550,295	T192I	probably benign	Het
Pbx3	C	T	2: 34,224,556	G122D	probably damaging	Het
Plcb3	A	G	19: 6,955,296	F1034L	probably benign	Het
Ppp2r1a	G	A	17: 20,955,974	V153I	probably benign	Het
Prss33	C	G	17: 23,835,141	M30I	probably benign	Het
Prss33	A	T	17: 23,835,142	M30K	probably benign	Het
R3hdm2	G	A	10: 127,495,091	S793N	probably benign	Het
Rab11fip5	C	T	6: 85,348,297	V343M	probably damaging	Het
Rere	A	G	4: 150,612,065		probably benign	Het
Rims1	G	T	1: 22,292,866	P52Q	probably damaging	Het
Scpep1	G	T	11: 88,952,434	S66*	probably null	Het
Setd2	A	G	9: 110,549,864	S632G	probably benign	Het
Shc3	A	T	13: 51,472,839	H129Q	probably damaging	Het
Slc22a20	A	T	19: 5,972,942	M391K	probably damaging	Het
Smurf1	A	T	5: 144,880,664	I712K	probably damaging	Het
Snx25	T	A	8: 46,049,473	I629L	probably damaging	Het
Supt16	A	C	14: 52,177,180	V425G	probably benign	Het
Tnik	G	A	3: 28,604,293	V576I	probably benign	Het
Trcg1	A	C	9: 57,245,573	D551A	probably damaging	Het
Ubald2	A	G	11: 116,434,352	N15S	probably damaging	Het
Usf1	T	C	1: 171,417,749	I243T	probably damaging	Het
Vmn2r19	A	T	6: 123,315,697	I233F	possibly damaging	Het
Vmn2r63	T	C	7: 42,928,211	N301S	probably benign	Het
Wdr27	A	G	17: 14,917,270	F419L	probably benign	Het

Other mutations in Ap3b2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00772:Ap3b2	APN	7	81471949	missense	probably damaging	0.98
IGL01695:Ap3b2	APN	7	81476939	splice site	probably benign
IGL01876:Ap3b2	APN	7	81473854	splice site	probably null
IGL02132:Ap3b2	APN	7	81460998	missense	unknown
IGL02227:Ap3b2	APN	7	81473404	missense	probably damaging	1.00
IGL02660:Ap3b2	APN	7	81465698	missense	probably benign	0.13
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0045:Ap3b2	UTSW	7	81466193	missense	possibly damaging	0.82
R0142:Ap3b2	UTSW	7	81473080	missense	probably damaging	0.96
R0317:Ap3b2	UTSW	7	81463681	splice site	probably null
R0568:Ap3b2	UTSW	7	81464629	critical splice donor site	probably null
R1035:Ap3b2	UTSW	7	81463911	missense	unknown
R1121:Ap3b2	UTSW	7	81464195	missense	unknown
R1160:Ap3b2	UTSW	7	81466169	critical splice donor site	probably null
R1489:Ap3b2	UTSW	7	81463690	nonsense	probably null
R1542:Ap3b2	UTSW	7	81478077	splice site	probably null
R1741:Ap3b2	UTSW	7	81467599	missense	possibly damaging	0.95
R1872:Ap3b2	UTSW	7	81464150	missense	unknown
R2065:Ap3b2	UTSW	7	81463774	missense	unknown
R2353:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2354:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R2398:Ap3b2	UTSW	7	81477195	missense	probably damaging	0.99
R3421:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3710:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3932:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R3933:Ap3b2	UTSW	7	81473850	unclassified	probably benign
R4152:Ap3b2	UTSW	7	81478017	missense	probably damaging	1.00
R4209:Ap3b2	UTSW	7	81477136	missense	probably benign	0.02
R4732:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4733:Ap3b2	UTSW	7	81471932	missense	probably damaging	1.00
R4841:Ap3b2	UTSW	7	81477930	missense	probably damaging	1.00
R5207:Ap3b2	UTSW	7	81476769	missense	possibly damaging	0.48
R5659:Ap3b2	UTSW	7	81476752	missense	probably damaging	0.98
R6109:Ap3b2	UTSW	7	81493592	missense	possibly damaging	0.55
R6223:Ap3b2	UTSW	7	81473462	nonsense	probably null
R6901:Ap3b2	UTSW	7	81484912	critical splice acceptor site	probably null
R6981:Ap3b2	UTSW	7	81477993	missense	probably damaging	1.00
R7061:Ap3b2	UTSW	7	81461009	missense	unknown
R7317:Ap3b2	UTSW	7	81461028	missense	unknown
R7501:Ap3b2	UTSW	7	81473446	missense	probably damaging	0.99
R7543:Ap3b2	UTSW	7	81466146	splice site	probably null
R7643:Ap3b2	UTSW	7	81477072	missense	probably benign	0.24
R7707:Ap3b2	UTSW	7	81476782	missense	possibly damaging	0.60
R8111:Ap3b2	UTSW	7	81463782	missense	unknown
R8273:Ap3b2	UTSW	7	81463242	missense	unknown
R8325:Ap3b2	UTSW	7	81484489	splice site	probably null
R8355:Ap3b2	UTSW	7	81473103	missense	probably damaging	1.00
R8697:Ap3b2	UTSW	7	81473035	missense	possibly damaging	0.91
R8716:Ap3b2	UTSW	7	81477153	missense	probably benign	0.03
R8923:Ap3b2	UTSW	7	81477183	missense	probably benign	0.08
R9002:Ap3b2	UTSW	7	81467444	missense	probably benign	0.02
R9163:Ap3b2	UTSW	7	81463798	missense	unknown
R9304:Ap3b2	UTSW	7	81463271	missense	unknown
R9321:Ap3b2	UTSW	7	81464504	critical splice acceptor site	probably null
R9413:Ap3b2	UTSW	7	81478009	missense	possibly damaging	0.45
R9459:Ap3b2	UTSW	7	81473903	missense	probably benign	0.16
R9746:Ap3b2	UTSW	7	81476344	missense	probably damaging	1.00
X0013:Ap3b2	UTSW	7	81463240	critical splice donor site	probably null
X0028:Ap3b2	UTSW	7	81463764	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TGCACACTAACTGAAGCAGATAGCC -3'
(R):5'- TCCCTGTGCTCAGAGAGAATTTCCC -3'

Sequencing Primer
(F):5'- TAACTGAAGCAGATAGCCAACAG -3'
(R):5'- GCTCAGAGAGAATTTCCCTGATG -3'

Posted On

2014-05-09