Incidental Mutation 'R1652:Olfr290'
ID188784
Institutional Source Beutler Lab
Gene Symbol Olfr290
Ensembl Gene ENSMUSG00000116179
Gene Name
SynonymsGA_x6K02T2NHDJ-11170115-11169168, MOR254-1
MMRRC Submission 039688-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.185) question?
Stock #R1652 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location84915781-84916728 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 84916520 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 247 (V247A)
Ref Sequence ENSEMBL: ENSMUSP00000149523 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073468] [ENSMUST00000214501] [ENSMUST00000216184] [ENSMUST00000216367]
Predicted Effect probably damaging
Transcript: ENSMUST00000073468
AA Change: V247A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073172
Gene: ENSMUSG00000116179
AA Change: V247A

DomainStartEndE-ValueType
Pfam:7tm_4 31 309 8.4e-53 PFAM
Pfam:7TM_GPCR_Srsx 35 304 1.2e-10 PFAM
Pfam:7tm_1 41 291 1.3e-30 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000173463
Predicted Effect probably damaging
Transcript: ENSMUST00000214501
AA Change: V247A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216184
AA Change: V247A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000216367
AA Change: V247A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,201,146 R969L probably damaging Het
Adam2 T A 14: 66,077,251 E37V probably benign Het
Adamts7 A G 9: 90,189,644 D664G probably damaging Het
Adamtsl5 A G 10: 80,342,177 V256A probably benign Het
Adrb1 C T 19: 56,723,273 S301L possibly damaging Het
Akap9 A G 5: 4,077,210 Y3686C probably damaging Het
Ap3b2 A G 7: 81,473,399 S456P probably damaging Het
Atp1a4 T C 1: 172,254,903 Y124C probably damaging Het
Bdkrb1 A T 12: 105,604,243 T23S probably damaging Het
Cacna1g A G 11: 94,427,404 Y1468H probably damaging Het
Cep170b A G 12: 112,733,513 D152G probably damaging Het
Cers4 T A 8: 4,516,908 probably null Het
Cyp2t4 A T 7: 27,157,390 D285V possibly damaging Het
Ddx56 A T 11: 6,267,679 L14Q probably damaging Het
Dennd2d C A 3: 106,487,001 R63S probably benign Het
Dnah7b T A 1: 46,175,390 L1105* probably null Het
Eef1e1 A T 13: 38,656,105 L75I possibly damaging Het
Fam76b A G 9: 13,835,892 S191G probably benign Het
Fat1 T A 8: 45,025,178 Y2420* probably null Het
Fbxw18 T A 9: 109,690,627 L270F probably benign Het
Fech T A 18: 64,458,198 H385L probably benign Het
Fkbp4 A T 6: 128,436,674 I2N probably damaging Het
Gda A T 19: 21,400,678 M339K probably damaging Het
Gdpgp1 T A 7: 80,239,364 M381K probably benign Het
Glyctk C A 9: 106,157,157 V173L probably damaging Het
Gm2056 T A 12: 88,027,083 V27E probably benign Het
Gtf2ird1 G A 5: 134,395,713 P393L probably damaging Het
Kat2a T C 11: 100,708,611 N517D probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama1 G A 17: 67,807,846 R2330Q probably damaging Het
Lamc1 C T 1: 153,249,646 G597E probably damaging Het
Lekr1 A T 3: 65,684,087 S82C probably benign Het
Lgi3 T C 14: 70,531,216 F51S probably damaging Het
Lrba T C 3: 86,539,938 S2030P probably damaging Het
Map4k5 A G 12: 69,830,427 probably null Het
Mcoln2 C A 3: 146,163,635 R32S possibly damaging Het
Metap1 A T 3: 138,462,390 F324L probably damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Ncf4 T A 15: 78,261,034 M274K possibly damaging Het
Nup205 T G 6: 35,238,966 V1747G probably benign Het
Olfr584 A G 7: 103,085,806 D91G probably benign Het
Olfr958 G A 9: 39,550,295 T192I probably benign Het
Pbx3 C T 2: 34,224,556 G122D probably damaging Het
Plcb3 A G 19: 6,955,296 F1034L probably benign Het
Ppp2r1a G A 17: 20,955,974 V153I probably benign Het
Prss33 C G 17: 23,835,141 M30I probably benign Het
Prss33 A T 17: 23,835,142 M30K probably benign Het
R3hdm2 G A 10: 127,495,091 S793N probably benign Het
Rab11fip5 C T 6: 85,348,297 V343M probably damaging Het
Rere A G 4: 150,612,065 probably benign Het
Rims1 G T 1: 22,292,866 P52Q probably damaging Het
Scpep1 G T 11: 88,952,434 S66* probably null Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc3 A T 13: 51,472,839 H129Q probably damaging Het
Slc22a20 A T 19: 5,972,942 M391K probably damaging Het
Smurf1 A T 5: 144,880,664 I712K probably damaging Het
Snx25 T A 8: 46,049,473 I629L probably damaging Het
Supt16 A C 14: 52,177,180 V425G probably benign Het
Tnik G A 3: 28,604,293 V576I probably benign Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Ubald2 A G 11: 116,434,352 N15S probably damaging Het
Usf1 T C 1: 171,417,749 I243T probably damaging Het
Vmn2r19 A T 6: 123,315,697 I233F possibly damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wdr27 A G 17: 14,917,270 F419L probably benign Het
Other mutations in Olfr290
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Olfr290 APN 7 84916370 missense probably damaging 0.99
IGL01322:Olfr290 APN 7 84916382 missense probably damaging 0.99
IGL01834:Olfr290 APN 7 84916652 missense probably damaging 1.00
IGL02556:Olfr290 APN 7 84916359 nonsense probably null
IGL03246:Olfr290 APN 7 84916711 missense probably benign 0.03
IGL03255:Olfr290 APN 7 84916517 missense possibly damaging 0.95
R0322:Olfr290 UTSW 7 84916313 missense probably damaging 1.00
R1253:Olfr290 UTSW 7 84916709 missense probably benign
R1673:Olfr290 UTSW 7 84916117 missense probably damaging 0.97
R1891:Olfr290 UTSW 7 84916253 missense possibly damaging 0.93
R1895:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R1946:Olfr290 UTSW 7 84916279 missense probably benign 0.01
R2128:Olfr290 UTSW 7 84916493 missense probably damaging 1.00
R4435:Olfr290 UTSW 7 84916021 missense probably benign 0.45
R4822:Olfr290 UTSW 7 84916426 missense possibly damaging 0.81
R4834:Olfr290 UTSW 7 84916283 missense probably damaging 1.00
R5354:Olfr290 UTSW 7 84916149 nonsense probably null
R5644:Olfr290 UTSW 7 84916119 missense probably benign 0.15
R5650:Olfr290 UTSW 7 84916418 missense possibly damaging 0.50
R5708:Olfr290 UTSW 7 84916183 missense possibly damaging 0.56
R6585:Olfr290 UTSW 7 84916462 missense probably damaging 0.99
R7774:Olfr290 UTSW 7 84916531 missense probably damaging 0.97
R8126:Olfr290 UTSW 7 84915906 missense probably damaging 1.00
R8443:Olfr290 UTSW 7 84916579 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACACAATGTCCACCTTTAGCCTGTC -3'
(R):5'- TGCATCATTCTCTCTGTGAACATATCCG -3'

Sequencing Primer
(F):5'- AGTACTACTGTGATATTCCACCTGTG -3'
(R):5'- CTCTCTGTGAACATATCCGAAGATG -3'
Posted On2014-05-09