Incidental Mutation 'R1652:Supt16'
ID188812
Institutional Source Beutler Lab
Gene Symbol Supt16
Ensembl Gene ENSMUSG00000035726
Gene Namesuppressor of Ty 16
SynonymsSupt16h, Spt16, Fact140, Cdc68
MMRRC Submission 039688-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.967) question?
Stock #R1652 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location52160414-52197416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 52177180 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 425 (V425G)
Ref Sequence ENSEMBL: ENSMUSP00000042283 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046709]
Predicted Effect probably benign
Transcript: ENSMUST00000046709
AA Change: V425G

PolyPhen 2 Score 0.336 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000042283
Gene: ENSMUSG00000035726
AA Change: V425G

DomainStartEndE-ValueType
FACT-Spt16_Nlob 5 168 2.95e-87 SMART
Pfam:Peptidase_M24 181 411 2.9e-35 PFAM
low complexity region 435 449 N/A INTRINSIC
coiled coil region 462 493 N/A INTRINSIC
SPT16 529 689 3.38e-96 SMART
Rtt106 806 896 1.61e-38 SMART
low complexity region 926 946 N/A INTRINSIC
low complexity region 951 988 N/A INTRINSIC
coiled coil region 994 1023 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Transcription of protein-coding genes can be reconstituted on naked DNA with only the general transcription factors and RNA polymerase II. However, this minimal system cannot transcribe DNA packaged into chromatin, indicating that accessory factors may facilitate access to DNA. One such factor, FACT (facilitates chromatin transcription), interacts specifically with histones H2A/H2B to effect nucleosome disassembly and transcription elongation. FACT is composed of an 80 kDa subunit and a 140 kDa subunit; this gene encodes the 140 kDa subunit. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,201,146 R969L probably damaging Het
Adam2 T A 14: 66,077,251 E37V probably benign Het
Adamts7 A G 9: 90,189,644 D664G probably damaging Het
Adamtsl5 A G 10: 80,342,177 V256A probably benign Het
Adrb1 C T 19: 56,723,273 S301L possibly damaging Het
Akap9 A G 5: 4,077,210 Y3686C probably damaging Het
Ap3b2 A G 7: 81,473,399 S456P probably damaging Het
Atp1a4 T C 1: 172,254,903 Y124C probably damaging Het
Bdkrb1 A T 12: 105,604,243 T23S probably damaging Het
Cacna1g A G 11: 94,427,404 Y1468H probably damaging Het
Cep170b A G 12: 112,733,513 D152G probably damaging Het
Cers4 T A 8: 4,516,908 probably null Het
Cyp2t4 A T 7: 27,157,390 D285V possibly damaging Het
Ddx56 A T 11: 6,267,679 L14Q probably damaging Het
Dennd2d C A 3: 106,487,001 R63S probably benign Het
Dnah7b T A 1: 46,175,390 L1105* probably null Het
Eef1e1 A T 13: 38,656,105 L75I possibly damaging Het
Fam76b A G 9: 13,835,892 S191G probably benign Het
Fat1 T A 8: 45,025,178 Y2420* probably null Het
Fbxw18 T A 9: 109,690,627 L270F probably benign Het
Fech T A 18: 64,458,198 H385L probably benign Het
Fkbp4 A T 6: 128,436,674 I2N probably damaging Het
Gda A T 19: 21,400,678 M339K probably damaging Het
Gdpgp1 T A 7: 80,239,364 M381K probably benign Het
Glyctk C A 9: 106,157,157 V173L probably damaging Het
Gm2056 T A 12: 88,027,083 V27E probably benign Het
Gtf2ird1 G A 5: 134,395,713 P393L probably damaging Het
Kat2a T C 11: 100,708,611 N517D probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lama1 G A 17: 67,807,846 R2330Q probably damaging Het
Lamc1 C T 1: 153,249,646 G597E probably damaging Het
Lekr1 A T 3: 65,684,087 S82C probably benign Het
Lgi3 T C 14: 70,531,216 F51S probably damaging Het
Lrba T C 3: 86,539,938 S2030P probably damaging Het
Map4k5 A G 12: 69,830,427 probably null Het
Mcoln2 C A 3: 146,163,635 R32S possibly damaging Het
Metap1 A T 3: 138,462,390 F324L probably damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Ncf4 T A 15: 78,261,034 M274K possibly damaging Het
Nup205 T G 6: 35,238,966 V1747G probably benign Het
Olfr290 T C 7: 84,916,520 V247A probably damaging Het
Olfr584 A G 7: 103,085,806 D91G probably benign Het
Olfr958 G A 9: 39,550,295 T192I probably benign Het
Pbx3 C T 2: 34,224,556 G122D probably damaging Het
Plcb3 A G 19: 6,955,296 F1034L probably benign Het
Ppp2r1a G A 17: 20,955,974 V153I probably benign Het
Prss33 C G 17: 23,835,141 M30I probably benign Het
Prss33 A T 17: 23,835,142 M30K probably benign Het
R3hdm2 G A 10: 127,495,091 S793N probably benign Het
Rab11fip5 C T 6: 85,348,297 V343M probably damaging Het
Rere A G 4: 150,612,065 probably benign Het
Rims1 G T 1: 22,292,866 P52Q probably damaging Het
Scpep1 G T 11: 88,952,434 S66* probably null Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc3 A T 13: 51,472,839 H129Q probably damaging Het
Slc22a20 A T 19: 5,972,942 M391K probably damaging Het
Smurf1 A T 5: 144,880,664 I712K probably damaging Het
Snx25 T A 8: 46,049,473 I629L probably damaging Het
Tnik G A 3: 28,604,293 V576I probably benign Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Ubald2 A G 11: 116,434,352 N15S probably damaging Het
Usf1 T C 1: 171,417,749 I243T probably damaging Het
Vmn2r19 A T 6: 123,315,697 I233F possibly damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wdr27 A G 17: 14,917,270 F419L probably benign Het
Other mutations in Supt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00950:Supt16 APN 14 52161798 missense possibly damaging 0.72
IGL00985:Supt16 APN 14 52161691 missense possibly damaging 0.53
IGL01160:Supt16 APN 14 52183132 missense probably benign
IGL01328:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01329:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01413:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01414:Supt16 APN 14 52177032 missense probably benign 0.20
IGL01535:Supt16 APN 14 52177190 missense probably damaging 0.99
IGL01765:Supt16 APN 14 52180223 missense probably damaging 0.98
IGL01976:Supt16 APN 14 52182307 missense possibly damaging 0.70
IGL02422:Supt16 APN 14 52179543 missense possibly damaging 0.85
IGL02449:Supt16 APN 14 52173806 missense possibly damaging 0.92
IGL02516:Supt16 APN 14 52183964 missense possibly damaging 0.57
IGL02831:Supt16 APN 14 52170878 missense possibly damaging 0.70
IGL03112:Supt16 APN 14 52176398 missense probably damaging 0.98
IGL03406:Supt16 APN 14 52178141 missense possibly damaging 0.92
R7336_Supt16_529 UTSW 14 52171491 missense possibly damaging 0.93
watercolor UTSW 14 52170881 missense probably damaging 0.96
R0332:Supt16 UTSW 14 52181157 missense probably damaging 0.99
R0385:Supt16 UTSW 14 52176718 missense probably benign 0.01
R0389:Supt16 UTSW 14 52174113 missense probably damaging 0.98
R0422:Supt16 UTSW 14 52183996 missense probably benign 0.26
R1101:Supt16 UTSW 14 52171439 missense probably null 0.81
R1212:Supt16 UTSW 14 52174124 nonsense probably null
R1487:Supt16 UTSW 14 52176608 critical splice donor site probably null
R1494:Supt16 UTSW 14 52172459 missense probably benign 0.01
R1566:Supt16 UTSW 14 52176655 missense probably damaging 0.99
R1913:Supt16 UTSW 14 52178135 missense possibly damaging 0.84
R2220:Supt16 UTSW 14 52172144 nonsense probably null
R2344:Supt16 UTSW 14 52178118 missense probably benign 0.00
R3430:Supt16 UTSW 14 52175359 missense probably benign 0.05
R3746:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R3749:Supt16 UTSW 14 52180139 missense probably damaging 0.99
R4010:Supt16 UTSW 14 52164441 missense probably damaging 1.00
R4108:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4109:Supt16 UTSW 14 52162731 missense probably damaging 1.00
R4597:Supt16 UTSW 14 52173589 missense probably damaging 1.00
R5117:Supt16 UTSW 14 52183092 missense probably damaging 1.00
R5309:Supt16 UTSW 14 52162698 missense probably damaging 1.00
R5695:Supt16 UTSW 14 52174144 splice site probably null
R5895:Supt16 UTSW 14 52164522 missense probably benign 0.17
R5941:Supt16 UTSW 14 52182196 missense probably benign
R5993:Supt16 UTSW 14 52178334 missense probably damaging 1.00
R6197:Supt16 UTSW 14 52170881 missense probably damaging 0.96
R6254:Supt16 UTSW 14 52170834 missense probably damaging 1.00
R6381:Supt16 UTSW 14 52179546 missense probably benign 0.02
R6667:Supt16 UTSW 14 52172063 missense probably damaging 1.00
R7000:Supt16 UTSW 14 52171450 missense probably damaging 0.97
R7063:Supt16 UTSW 14 52172048 missense possibly damaging 0.92
R7276:Supt16 UTSW 14 52177001 missense probably benign
R7336:Supt16 UTSW 14 52171491 missense possibly damaging 0.93
R7344:Supt16 UTSW 14 52173571 missense probably damaging 0.98
R7384:Supt16 UTSW 14 52181162 missense probably damaging 0.99
R7411:Supt16 UTSW 14 52178051 missense probably damaging 1.00
R7586:Supt16 UTSW 14 52173556 missense probably damaging 0.97
R7633:Supt16 UTSW 14 52197099 missense probably benign 0.38
R8024:Supt16 UTSW 14 52170875 missense probably damaging 0.96
R8197:Supt16 UTSW 14 52174085 missense possibly damaging 0.95
R8201:Supt16 UTSW 14 52170990 missense probably damaging 1.00
R8285:Supt16 UTSW 14 52181083 missense possibly damaging 0.95
R8508:Supt16 UTSW 14 52181589 missense probably damaging 1.00
R8531:Supt16 UTSW 14 52172563 missense probably damaging 0.98
R8797:Supt16 UTSW 14 52172503 missense probably damaging 0.99
R8872:Supt16 UTSW 14 52174087 missense probably benign 0.01
Z1177:Supt16 UTSW 14 52163285 missense possibly damaging 0.63
Z1177:Supt16 UTSW 14 52181537 missense probably null 0.21
Predicted Primers PCR Primer
(F):5'- AAGTAATGCCGCCCTAGAGCCTCTTC -3'
(R):5'- CAGAGCTAGGTAAGGCCAGATCTCAAG -3'

Sequencing Primer
(F):5'- cctctgcctcatctttctcttc -3'
(R):5'- AGCATTGCTTAGGTCATAGTTCC -3'
Posted On2014-05-09