Incidental Mutation 'R1652:Lama1'
Institutional Source Beutler Lab
Gene Symbol Lama1
Ensembl Gene ENSMUSG00000032796
Gene Namelaminin, alpha 1
MMRRC Submission 039688-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R1652 (G1)
Quality Score225
Status Not validated
Chromosomal Location67697265-67822645 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 67807846 bp
Amino Acid Change Arginine to Glutamine at position 2330 (R2330Q)
Ref Sequence ENSEMBL: ENSMUSP00000043957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035471]
Predicted Effect probably damaging
Transcript: ENSMUST00000035471
AA Change: R2330Q

PolyPhen 2 Score 0.967 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000043957
Gene: ENSMUSG00000032796
AA Change: R2330Q

low complexity region 3 22 N/A INTRINSIC
LamNT 23 275 1.2e-131 SMART
EGF_Lam 277 331 1e-5 SMART
EGF_Lam 334 401 6.6e-6 SMART
EGF_Lam 404 458 9.11e-9 SMART
EGF_Lam 461 507 8.12e-6 SMART
LamB 570 702 2.09e-57 SMART
EGF_like 715 746 3.36e0 SMART
EGF_Lam 749 795 7.01e-10 SMART
EGF_Lam 798 853 3.59e-7 SMART
EGF_Lam 856 906 1.53e-10 SMART
EGF_Lam 909 955 1.13e-13 SMART
EGF_Lam 958 1002 1.36e-7 SMART
EGF_Lam 1005 1048 7.29e-8 SMART
EGF_like 1034 1082 4.83e1 SMART
EGF_Lam 1051 1094 1.67e-7 SMART
EGF_Lam 1097 1154 1.32e-5 SMART
LamB 1220 1352 8.7e-46 SMART
Pfam:Laminin_EGF 1367 1397 1.7e-6 PFAM
EGF_Lam 1410 1456 7.12e-11 SMART
EGF_Lam 1459 1513 3.25e-5 SMART
EGF_like 1497 1547 6.41e1 SMART
EGF_Lam 1516 1560 1.71e-13 SMART
Pfam:Laminin_I 1574 1838 1.7e-91 PFAM
low complexity region 2012 2031 N/A INTRINSIC
low complexity region 2087 2098 N/A INTRINSIC
LamG 2145 2287 3.66e-30 SMART
LamG 2332 2473 5.98e-35 SMART
LamG 2513 2661 1.11e-29 SMART
low complexity region 2695 2708 N/A INTRINSIC
LamG 2743 2877 9.72e-35 SMART
LamG 2920 3056 4.63e-41 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.2%
  • 20x: 92.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the alpha 1 subunits of laminin. The laminins are a family of extracellular matrix glycoproteins that have a heterotrimeric structure consisting of an alpha, beta and gamma chain. These proteins make up a major component of the basement membrane and have been implicated in a wide variety of biological processes including cell adhesion, differentiation, migration, signaling, neurite outgrowth and metastasis. Mutations in this gene may be associated with Poretti-Boltshauser syndrome. [provided by RefSeq, Sep 2014]
PHENOTYPE: Homozygous null mice display embryonic lethality before somite formation with impaired formation of Reichert's membrane. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 65 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik G T 15: 8,201,146 R969L probably damaging Het
Adam2 T A 14: 66,077,251 E37V probably benign Het
Adamts7 A G 9: 90,189,644 D664G probably damaging Het
Adamtsl5 A G 10: 80,342,177 V256A probably benign Het
Adrb1 C T 19: 56,723,273 S301L possibly damaging Het
Akap9 A G 5: 4,077,210 Y3686C probably damaging Het
Ap3b2 A G 7: 81,473,399 S456P probably damaging Het
Atp1a4 T C 1: 172,254,903 Y124C probably damaging Het
Bdkrb1 A T 12: 105,604,243 T23S probably damaging Het
Cacna1g A G 11: 94,427,404 Y1468H probably damaging Het
Cep170b A G 12: 112,733,513 D152G probably damaging Het
Cers4 T A 8: 4,516,908 probably null Het
Cyp2t4 A T 7: 27,157,390 D285V possibly damaging Het
Ddx56 A T 11: 6,267,679 L14Q probably damaging Het
Dennd2d C A 3: 106,487,001 R63S probably benign Het
Dnah7b T A 1: 46,175,390 L1105* probably null Het
Eef1e1 A T 13: 38,656,105 L75I possibly damaging Het
Fam76b A G 9: 13,835,892 S191G probably benign Het
Fat1 T A 8: 45,025,178 Y2420* probably null Het
Fbxw18 T A 9: 109,690,627 L270F probably benign Het
Fech T A 18: 64,458,198 H385L probably benign Het
Fkbp4 A T 6: 128,436,674 I2N probably damaging Het
Gda A T 19: 21,400,678 M339K probably damaging Het
Gdpgp1 T A 7: 80,239,364 M381K probably benign Het
Glyctk C A 9: 106,157,157 V173L probably damaging Het
Gm2056 T A 12: 88,027,083 V27E probably benign Het
Gtf2ird1 G A 5: 134,395,713 P393L probably damaging Het
Kat2a T C 11: 100,708,611 N517D probably damaging Het
Krt84 G A 15: 101,525,963 S523F possibly damaging Het
Lamc1 C T 1: 153,249,646 G597E probably damaging Het
Lekr1 A T 3: 65,684,087 S82C probably benign Het
Lgi3 T C 14: 70,531,216 F51S probably damaging Het
Lrba T C 3: 86,539,938 S2030P probably damaging Het
Map4k5 A G 12: 69,830,427 probably null Het
Mcoln2 C A 3: 146,163,635 R32S possibly damaging Het
Metap1 A T 3: 138,462,390 F324L probably damaging Het
Moxd2 C T 6: 40,887,403 R31H probably damaging Het
Ncf4 T A 15: 78,261,034 M274K possibly damaging Het
Nup205 T G 6: 35,238,966 V1747G probably benign Het
Olfr290 T C 7: 84,916,520 V247A probably damaging Het
Olfr584 A G 7: 103,085,806 D91G probably benign Het
Olfr958 G A 9: 39,550,295 T192I probably benign Het
Pbx3 C T 2: 34,224,556 G122D probably damaging Het
Plcb3 A G 19: 6,955,296 F1034L probably benign Het
Ppp2r1a G A 17: 20,955,974 V153I probably benign Het
Prss33 C G 17: 23,835,141 M30I probably benign Het
Prss33 A T 17: 23,835,142 M30K probably benign Het
R3hdm2 G A 10: 127,495,091 S793N probably benign Het
Rab11fip5 C T 6: 85,348,297 V343M probably damaging Het
Rere A G 4: 150,612,065 probably benign Het
Rims1 G T 1: 22,292,866 P52Q probably damaging Het
Scpep1 G T 11: 88,952,434 S66* probably null Het
Setd2 A G 9: 110,549,864 S632G probably benign Het
Shc3 A T 13: 51,472,839 H129Q probably damaging Het
Slc22a20 A T 19: 5,972,942 M391K probably damaging Het
Smurf1 A T 5: 144,880,664 I712K probably damaging Het
Snx25 T A 8: 46,049,473 I629L probably damaging Het
Supt16 A C 14: 52,177,180 V425G probably benign Het
Tnik G A 3: 28,604,293 V576I probably benign Het
Trcg1 A C 9: 57,245,573 D551A probably damaging Het
Ubald2 A G 11: 116,434,352 N15S probably damaging Het
Usf1 T C 1: 171,417,749 I243T probably damaging Het
Vmn2r19 A T 6: 123,315,697 I233F possibly damaging Het
Vmn2r63 T C 7: 42,928,211 N301S probably benign Het
Wdr27 A G 17: 14,917,270 F419L probably benign Het
Other mutations in Lama1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Lama1 APN 17 67815928 missense probably benign
IGL00336:Lama1 APN 17 67813948 missense probably benign 0.07
IGL01066:Lama1 APN 17 67743326 missense probably damaging 1.00
IGL01140:Lama1 APN 17 67802933 missense probably benign 0.14
IGL01291:Lama1 APN 17 67738870 missense probably damaging 1.00
IGL01296:Lama1 APN 17 67745051 missense probably benign 0.27
IGL01317:Lama1 APN 17 67818701 missense probably damaging 1.00
IGL01490:Lama1 APN 17 67750584 missense possibly damaging 0.54
IGL01506:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01508:Lama1 APN 17 67809361 splice site probably benign
IGL01522:Lama1 APN 17 67752774 splice site probably benign
IGL01530:Lama1 APN 17 67796790 missense probably benign 0.02
IGL01541:Lama1 APN 17 67785070 missense probably benign 0.01
IGL01677:Lama1 APN 17 67779148 missense probably benign 0.15
IGL01886:Lama1 APN 17 67807797 missense probably benign 0.36
IGL01994:Lama1 APN 17 67752439 missense probably benign 0.05
IGL02017:Lama1 APN 17 67764725 missense probably benign 0.00
IGL02021:Lama1 APN 17 67821626 missense probably damaging 1.00
IGL02026:Lama1 APN 17 67809292 missense possibly damaging 0.82
IGL02044:Lama1 APN 17 67811490 missense probably benign 0.01
IGL02120:Lama1 APN 17 67716789 missense probably damaging 1.00
IGL02425:Lama1 APN 17 67811485 missense probably benign 0.45
IGL02549:Lama1 APN 17 67790835 missense possibly damaging 0.93
IGL02642:Lama1 APN 17 67812366 missense probably benign 0.00
IGL02795:Lama1 APN 17 67738894 splice site probably null
IGL02798:Lama1 APN 17 67795191 splice site probably benign
IGL02863:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02870:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02876:Lama1 APN 17 67750692 critical splice donor site probably null
IGL02885:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02891:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL02978:Lama1 APN 17 67786081 nonsense probably null
IGL03064:Lama1 APN 17 67779104 missense probably benign 0.01
IGL03076:Lama1 APN 17 67716799 missense possibly damaging 0.95
IGL03110:Lama1 APN 17 67798986 missense probably benign 0.04
IGL03143:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03159:Lama1 APN 17 67804536 missense probably damaging 0.99
IGL03268:Lama1 APN 17 67804536 missense probably damaging 0.99
ANU05:Lama1 UTSW 17 67738870 missense probably damaging 1.00
PIT4472001:Lama1 UTSW 17 67764704 missense
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0047:Lama1 UTSW 17 67795186 splice site probably benign
R0050:Lama1 UTSW 17 67782056 missense possibly damaging 0.66
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0096:Lama1 UTSW 17 67805413 missense probably benign 0.12
R0111:Lama1 UTSW 17 67737498 missense probably damaging 0.98
R0116:Lama1 UTSW 17 67776923 missense probably benign 0.10
R0121:Lama1 UTSW 17 67798513 splice site probably benign
R0278:Lama1 UTSW 17 67810183 missense probably null 0.98
R0281:Lama1 UTSW 17 67817569 missense probably damaging 1.00
R0312:Lama1 UTSW 17 67775851 missense possibly damaging 0.45
R0419:Lama1 UTSW 17 67791610 critical splice donor site probably null
R0512:Lama1 UTSW 17 67779134 missense possibly damaging 0.67
R0514:Lama1 UTSW 17 67764698 missense probably benign 0.40
R0562:Lama1 UTSW 17 67815959 missense probably damaging 1.00
R0632:Lama1 UTSW 17 67752368 splice site probably benign
R0645:Lama1 UTSW 17 67773712 missense probably benign 0.01
R0712:Lama1 UTSW 17 67779042 splice site probably null
R0763:Lama1 UTSW 17 67772818 missense probably damaging 0.97
R0941:Lama1 UTSW 17 67775865 missense probably benign 0.10
R1025:Lama1 UTSW 17 67752898 missense probably benign 0.00
R1084:Lama1 UTSW 17 67804469 missense probably benign 0.12
R1103:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1420:Lama1 UTSW 17 67790947 missense probably damaging 0.98
R1430:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R1569:Lama1 UTSW 17 67780618 splice site probably null
R1575:Lama1 UTSW 17 67810409 missense possibly damaging 0.96
R1613:Lama1 UTSW 17 67807923 missense probably benign 0.42
R1620:Lama1 UTSW 17 67767033 missense probably benign 0.01
R1629:Lama1 UTSW 17 67805428 missense probably benign 0.00
R1645:Lama1 UTSW 17 67737682 missense probably benign 0.14
R1674:Lama1 UTSW 17 67791244 missense probably benign
R1678:Lama1 UTSW 17 67810155 missense possibly damaging 0.56
R1710:Lama1 UTSW 17 67753791 missense probably benign 0.00
R1712:Lama1 UTSW 17 67717186 missense possibly damaging 0.95
R1737:Lama1 UTSW 17 67802921 missense probably benign 0.36
R1757:Lama1 UTSW 17 67763836 missense probably benign 0.40
R1757:Lama1 UTSW 17 67697383 missense unknown
R1813:Lama1 UTSW 17 67791223 missense probably benign
R1896:Lama1 UTSW 17 67791223 missense probably benign
R1945:Lama1 UTSW 17 67745853 missense probably benign 0.14
R2086:Lama1 UTSW 17 67817623 missense probably damaging 1.00
R2149:Lama1 UTSW 17 67773865 missense possibly damaging 0.95
R2178:Lama1 UTSW 17 67769515 missense probably benign 0.07
R2183:Lama1 UTSW 17 67791009 missense probably damaging 0.98
R2197:Lama1 UTSW 17 67752941 missense probably benign 0.02
R2213:Lama1 UTSW 17 67777034 nonsense probably null
R2260:Lama1 UTSW 17 67737507 missense probably damaging 0.96
R2356:Lama1 UTSW 17 67810114 missense probably damaging 1.00
R2420:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2421:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2422:Lama1 UTSW 17 67750553 missense probably benign 0.00
R2424:Lama1 UTSW 17 67798665 missense probably benign 0.09
R2442:Lama1 UTSW 17 67768317 missense probably benign 0.04
R3147:Lama1 UTSW 17 67737658 missense probably damaging 0.98
R3414:Lama1 UTSW 17 67737603 missense probably damaging 1.00
R3683:Lama1 UTSW 17 67768333 missense probably benign 0.40
R3820:Lama1 UTSW 17 67779046 splice site probably null
R3821:Lama1 UTSW 17 67779046 splice site probably null
R3822:Lama1 UTSW 17 67779046 splice site probably null
R4012:Lama1 UTSW 17 67812373 nonsense probably null
R4113:Lama1 UTSW 17 67764703 missense probably benign 0.01
R4133:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R4133:Lama1 UTSW 17 67812486 missense probably damaging 1.00
R4259:Lama1 UTSW 17 67752418 missense possibly damaging 0.95
R4278:Lama1 UTSW 17 67791517 missense probably null 0.00
R4321:Lama1 UTSW 17 67771083 missense probably benign 0.03
R4374:Lama1 UTSW 17 67804518 missense probably benign 0.00
R4386:Lama1 UTSW 17 67773712 missense probably benign 0.01
R4463:Lama1 UTSW 17 67761700 missense probably damaging 1.00
R4629:Lama1 UTSW 17 67805360 critical splice acceptor site probably null
R4630:Lama1 UTSW 17 67794300 missense probably benign 0.00
R4633:Lama1 UTSW 17 67798584 missense probably damaging 0.96
R4668:Lama1 UTSW 17 67752434 missense probably benign 0.27
R4684:Lama1 UTSW 17 67773778 missense possibly damaging 0.88
R4745:Lama1 UTSW 17 67738780 missense probably damaging 1.00
R4786:Lama1 UTSW 17 67773859 missense possibly damaging 0.77
R4797:Lama1 UTSW 17 67716775 missense probably benign 0.04
R4803:Lama1 UTSW 17 67809271 missense probably damaging 1.00
R4925:Lama1 UTSW 17 67794314 missense probably benign 0.02
R4939:Lama1 UTSW 17 67737475 missense possibly damaging 0.91
R4952:Lama1 UTSW 17 67767566 critical splice donor site probably null
R4975:Lama1 UTSW 17 67738834 missense possibly damaging 0.95
R4977:Lama1 UTSW 17 67737682 missense probably damaging 1.00
R5039:Lama1 UTSW 17 67745893 missense possibly damaging 0.66
R5047:Lama1 UTSW 17 67743281 nonsense probably null
R5195:Lama1 UTSW 17 67764800 missense probably benign 0.13
R5230:Lama1 UTSW 17 67745083 nonsense probably null
R5236:Lama1 UTSW 17 67804492 missense probably benign 0.24
R5254:Lama1 UTSW 17 67756716 missense probably benign 0.01
R5345:Lama1 UTSW 17 67817563 missense probably benign
R5438:Lama1 UTSW 17 67800774 missense possibly damaging 0.92
R5521:Lama1 UTSW 17 67780894 nonsense probably null
R5568:Lama1 UTSW 17 67768298 critical splice acceptor site probably null
R5645:Lama1 UTSW 17 67802948 missense probably damaging 1.00
R5665:Lama1 UTSW 17 67770987 missense probably damaging 1.00
R5727:Lama1 UTSW 17 67815224 missense possibly damaging 0.81
R5757:Lama1 UTSW 17 67738787 missense possibly damaging 0.59
R5795:Lama1 UTSW 17 67796727 missense probably benign 0.02
R5857:Lama1 UTSW 17 67807843 missense probably damaging 0.99
R5894:Lama1 UTSW 17 67779047 critical splice acceptor site probably null
R5974:Lama1 UTSW 17 67773727 missense probably benign 0.31
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6032:Lama1 UTSW 17 67750643 missense probably benign 0.01
R6120:Lama1 UTSW 17 67780617 critical splice donor site probably null
R6219:Lama1 UTSW 17 67790856 missense probably benign 0.08
R6224:Lama1 UTSW 17 67802987 missense possibly damaging 0.56
R6249:Lama1 UTSW 17 67798604 missense probably benign
R6265:Lama1 UTSW 17 67750655 missense probably damaging 0.98
R6276:Lama1 UTSW 17 67784088 splice site probably null
R6284:Lama1 UTSW 17 67810096 missense probably damaging 0.99
R6337:Lama1 UTSW 17 67786019 missense probably benign 0.27
R6414:Lama1 UTSW 17 67746910 critical splice donor site probably null
R6631:Lama1 UTSW 17 67774482 missense probably benign 0.21
R6659:Lama1 UTSW 17 67818635 missense probably damaging 1.00
R6660:Lama1 UTSW 17 67804500 missense probably benign 0.05
R6677:Lama1 UTSW 17 67795233 missense probably benign 0.14
R6763:Lama1 UTSW 17 67746873 missense unknown
R6787:Lama1 UTSW 17 67784025 missense unknown
R6831:Lama1 UTSW 17 67756754 missense possibly damaging 0.89
R6855:Lama1 UTSW 17 67782155 missense possibly damaging 0.95
R6910:Lama1 UTSW 17 67791464 missense possibly damaging 0.60
R6934:Lama1 UTSW 17 67774543 missense probably benign 0.04
R6945:Lama1 UTSW 17 67813866 missense
R6984:Lama1 UTSW 17 67779112 missense
R6989:Lama1 UTSW 17 67753758 missense
R6994:Lama1 UTSW 17 67753825 missense
R6995:Lama1 UTSW 17 67753825 missense
R7035:Lama1 UTSW 17 67781049 missense
R7133:Lama1 UTSW 17 67782146 missense
R7172:Lama1 UTSW 17 67804545 missense
R7197:Lama1 UTSW 17 67737705 nonsense probably null
R7217:Lama1 UTSW 17 67764673 missense
R7229:Lama1 UTSW 17 67752446 missense
R7264:Lama1 UTSW 17 67743297 missense
R7311:Lama1 UTSW 17 67767385 missense
R7394:Lama1 UTSW 17 67717261 missense
R7419:Lama1 UTSW 17 67717174 missense
R7460:Lama1 UTSW 17 67767018 missense
R7492:Lama1 UTSW 17 67817651 missense
R7494:Lama1 UTSW 17 67811446 missense
R7552:Lama1 UTSW 17 67737667 missense
R7576:Lama1 UTSW 17 67782041 missense
R7583:Lama1 UTSW 17 67761621 missense
R7649:Lama1 UTSW 17 67737554 missense
R7663:Lama1 UTSW 17 67780880 missense
R7667:Lama1 UTSW 17 67780597 missense
R7688:Lama1 UTSW 17 67761628 missense
R7693:Lama1 UTSW 17 67817031 missense
R7748:Lama1 UTSW 17 67750590 missense
R7778:Lama1 UTSW 17 67804473 missense
R7824:Lama1 UTSW 17 67804473 missense
R7861:Lama1 UTSW 17 67809221 missense
R7884:Lama1 UTSW 17 67769435 missense
R7944:Lama1 UTSW 17 67809221 missense
R7967:Lama1 UTSW 17 67769435 missense
RF001:Lama1 UTSW 17 67752902 missense
RF013:Lama1 UTSW 17 67781062 missense
V8831:Lama1 UTSW 17 67752883 missense probably benign 0.00
X0024:Lama1 UTSW 17 67738888 missense probably damaging 1.00
X0028:Lama1 UTSW 17 67767422 missense probably benign 0.00
X0028:Lama1 UTSW 17 67794310 missense probably benign 0.06
X0066:Lama1 UTSW 17 67811566 missense probably damaging 1.00
Z1088:Lama1 UTSW 17 67752883 missense probably benign 0.00
Z1088:Lama1 UTSW 17 67771082 missense probably benign 0.25
Z1088:Lama1 UTSW 17 67810171 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- ttactaactcctccttcattctcc -3'
Posted On2014-05-09