Incidental Mutation 'R1653:Capn10'
ID 188831
Institutional Source Beutler Lab
Gene Symbol Capn10
Ensembl Gene ENSMUSG00000026270
Gene Name calpain 10
Synonyms Capn8
MMRRC Submission 039689-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.098) question?
Stock # R1653 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 92934376-92947941 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 92946898 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Tyrosine to Cysteine at position 617 (Y617C)
Ref Sequence ENSEMBL: ENSMUSP00000027488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027488] [ENSMUST00000152983] [ENSMUST00000185421]
AlphaFold Q9ESK3
Predicted Effect probably damaging
Transcript: ENSMUST00000027488
AA Change: Y617C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027488
Gene: ENSMUSG00000026270
AA Change: Y617C

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.05e-60 SMART
calpain_III 507 645 1.3e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136598
Predicted Effect probably benign
Transcript: ENSMUST00000152983
SMART Domains Protein: ENSMUSP00000122158
Gene: ENSMUSG00000026270

DomainStartEndE-ValueType
CysPc 2 329 1.75e-59 SMART
calpain_III 338 488 2.71e-60 SMART
low complexity region 490 499 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153828
Predicted Effect probably benign
Transcript: ENSMUST00000185421
Predicted Effect probably benign
Transcript: ENSMUST00000187342
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191563
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Calpains represent a ubiquitous, well-conserved family of calcium-dependent cysteine proteases. The calpain proteins are heterodimers consisting of an invariant small subunit and variable large subunits. The large catalytic subunit has four domains: domain I, the N-terminal regulatory domain that is processed upon calpain activation; domain II, the protease domain; domain III, a linker domain of unknown function; and domain IV, the calmodulin-like calcium-binding domain. This gene encodes a large subunit. It is an atypical calpain in that it lacks the calmodulin-like calcium-binding domain and instead has a divergent C-terminal domain. It is similar in organization to calpains 5 and 6. This gene is associated with type 2 or non-insulin-dependent diabetes mellitus (NIDDM), and is located within the NIDDM1 region. Multiple alternative transcript variants have been described for this gene. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit resistance to ryanodine- and palmitate-induced pancreatic apoptosis. Mice homozygous for a different knock-out allele exhibit increased adiposity, body and organ weights, and leptin serum levels on background containing LG/J. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Capn10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00902:Capn10 APN 1 92942559 missense probably benign 0.00
IGL01071:Capn10 APN 1 92945075 missense probably damaging 1.00
IGL01682:Capn10 APN 1 92940384 missense probably benign 0.16
IGL01771:Capn10 APN 1 92940365 missense probably damaging 1.00
IGL02952:Capn10 APN 1 92945174 missense probably damaging 0.97
IGL03177:Capn10 APN 1 92934982 missense probably benign 0.02
IGL03224:Capn10 APN 1 92939324 missense probably damaging 1.00
P4717OSA:Capn10 UTSW 1 92939394 missense probably damaging 1.00
R1256:Capn10 UTSW 1 92946946 missense probably damaging 1.00
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1405:Capn10 UTSW 1 92945022 missense probably benign 0.34
R1737:Capn10 UTSW 1 92934955 missense probably benign 0.10
R2127:Capn10 UTSW 1 92938034 nonsense probably null
R2433:Capn10 UTSW 1 92942525 missense probably benign 0.22
R2484:Capn10 UTSW 1 92944843 missense probably damaging 0.97
R4004:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4005:Capn10 UTSW 1 92940591 missense probably damaging 0.98
R4560:Capn10 UTSW 1 92939362 missense probably damaging 1.00
R4684:Capn10 UTSW 1 92943781 missense probably damaging 1.00
R4766:Capn10 UTSW 1 92943419 missense probably damaging 0.98
R4996:Capn10 UTSW 1 92945136 missense probably damaging 1.00
R5665:Capn10 UTSW 1 92937931 splice site probably null
R5733:Capn10 UTSW 1 92943913 missense probably benign 0.03
R5937:Capn10 UTSW 1 92939383 missense probably damaging 1.00
R6985:Capn10 UTSW 1 92943424 missense probably damaging 1.00
R7140:Capn10 UTSW 1 92945271 missense possibly damaging 0.85
R7495:Capn10 UTSW 1 92943370 missense probably damaging 1.00
R8170:Capn10 UTSW 1 92934964 missense probably damaging 0.98
R8393:Capn10 UTSW 1 92943408 missense probably benign 0.09
R8943:Capn10 UTSW 1 92943732 missense probably damaging 1.00
R9303:Capn10 UTSW 1 92943943 critical splice donor site probably null
R9305:Capn10 UTSW 1 92943943 critical splice donor site probably null
R9655:Capn10 UTSW 1 92939389 missense probably damaging 1.00
R9776:Capn10 UTSW 1 92943864 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- TGCAGAGTGAGAGCAAACCATGCC -3'
(R):5'- AGACCAGCAGGGAGTCTCAAAGTC -3'

Sequencing Primer
(F):5'- CACCCTGAATGGGCCTC -3'
(R):5'- ACCTCTTGGCTCTGCTAGAAAG -3'
Posted On 2014-05-09