Incidental Mutation 'R1653:Capn8'
ID188833
Institutional Source Beutler Lab
Gene Symbol Capn8
Ensembl Gene ENSMUSG00000038599
Gene Namecalpain 8
SynonymsnCL-2, nCL-2'
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location182565007-182632352 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 182623951 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 578 (N578D)
Ref Sequence ENSEMBL: ENSMUSP00000141275 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048941] [ENSMUST00000192671]
Predicted Effect probably benign
Transcript: ENSMUST00000048941
AA Change: N578D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000047164
Gene: ENSMUSG00000038599
AA Change: N578D

DomainStartEndE-ValueType
CysPc 27 352 5.02e-183 SMART
calpain_III 355 512 5.34e-91 SMART
EFh 579 607 3.12e0 SMART
EFh 609 637 4.32e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192671
AA Change: N578D

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000141275
Gene: ENSMUSG00000038599
AA Change: N578D

DomainStartEndE-ValueType
CysPc 27 352 2.2e-185 SMART
calpain_III 355 512 1.4e-93 SMART
EFh 579 607 1.5e-2 SMART
EFh 609 637 2.1e-1 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele or allele that produces a proteolytically inactive protein exhibit increased sensitivity to ethanol-induced gastric mucosa injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Capn8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01880:Capn8 APN 1 182597576 missense probably damaging 1.00
IGL02814:Capn8 APN 1 182598771 missense probably damaging 1.00
R0063:Capn8 UTSW 1 182602112 missense probably damaging 1.00
R0063:Capn8 UTSW 1 182602112 missense probably damaging 1.00
R0330:Capn8 UTSW 1 182630138 missense probably benign 0.30
R1679:Capn8 UTSW 1 182613467 missense probably damaging 1.00
R1783:Capn8 UTSW 1 182598822 missense probably damaging 1.00
R1819:Capn8 UTSW 1 182598826 missense probably damaging 1.00
R1831:Capn8 UTSW 1 182611101 critical splice donor site probably null
R2045:Capn8 UTSW 1 182613386 missense probably benign 0.00
R2298:Capn8 UTSW 1 182613420 missense probably benign 0.29
R4331:Capn8 UTSW 1 182604454 missense probably damaging 1.00
R4485:Capn8 UTSW 1 182598741 missense possibly damaging 0.76
R4835:Capn8 UTSW 1 182604551 missense probably damaging 0.98
R5055:Capn8 UTSW 1 182571961 missense probably damaging 1.00
R5224:Capn8 UTSW 1 182596989 missense probably damaging 1.00
R5327:Capn8 UTSW 1 182628604 missense probably benign 0.03
R5497:Capn8 UTSW 1 182620180 missense probably benign
R6307:Capn8 UTSW 1 182607699 missense probably damaging 0.98
R6895:Capn8 UTSW 1 182628669 missense possibly damaging 0.51
R7216:Capn8 UTSW 1 182598798 missense possibly damaging 0.89
R7438:Capn8 UTSW 1 182598675 missense probably damaging 1.00
R8258:Capn8 UTSW 1 182565133 missense probably benign 0.00
R8259:Capn8 UTSW 1 182565133 missense probably benign 0.00
R8334:Capn8 UTSW 1 182611105 splice site probably null
R8837:Capn8 UTSW 1 182628634 missense possibly damaging 0.88
Z1177:Capn8 UTSW 1 182613346 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCCACAGCTTGAAGCACAATG -3'
(R):5'- TCCCAGGTGTGGCAAAGACAAC -3'

Sequencing Primer
(F):5'- CTTGAAGCACAATGCCAGGG -3'
(R):5'- CTTCCTGGAAAAAGGTAGAGGAGC -3'
Posted On2014-05-09