Incidental Mutation 'R1653:Pdk1'
ID188834
Institutional Source Beutler Lab
Gene Symbol Pdk1
Ensembl Gene ENSMUSG00000006494
Gene Namepyruvate dehydrogenase kinase, isoenzyme 1
Synonyms
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location71873224-71903858 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 71888995 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000006669 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006669]
Predicted Effect probably null
Transcript: ENSMUST00000006669
SMART Domains Protein: ENSMUSP00000006669
Gene: ENSMUSG00000006494

DomainStartEndE-ValueType
low complexity region 22 38 N/A INTRINSIC
Pfam:BCDHK_Adom3 56 218 6.4e-52 PFAM
HATPase_c 266 391 1.82e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129427
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134362
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148249
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151358
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156036
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pyruvate dehydrogenase (PDH) is a mitochondrial multienzyme complex that catalyzes the oxidative decarboxylation of pyruvate and is one of the major enzymes responsible for the regulation of homeostasis of carbohydrate fuels in mammals. The enzymatic activity is regulated by a phosphorylation/dephosphorylation cycle. Phosphorylation of PDH by a specific pyruvate dehydrogenase kinase (PDK) results in inactivation. Multiple alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jun 2013]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Pdk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01409:Pdk1 APN 2 71895779 missense probably benign 0.00
IGL01643:Pdk1 APN 2 71897705 missense probably damaging 1.00
IGL02672:Pdk1 APN 2 71895752 missense probably damaging 1.00
IGL02833:Pdk1 APN 2 71897645 critical splice acceptor site probably null
IGL03271:Pdk1 APN 2 71880030 splice site probably benign
IGL03400:Pdk1 APN 2 71895747 missense probably benign 0.25
R0329:Pdk1 UTSW 2 71895674 splice site probably benign
R0564:Pdk1 UTSW 2 71880039 nonsense probably null
R2570:Pdk1 UTSW 2 71873560 missense possibly damaging 0.56
R5137:Pdk1 UTSW 2 71883569 missense possibly damaging 0.90
R5932:Pdk1 UTSW 2 71883416 splice site probably null
R6109:Pdk1 UTSW 2 71883506 missense probably benign 0.23
R7107:Pdk1 UTSW 2 71895741 missense probably benign 0.00
R7227:Pdk1 UTSW 2 71883901 missense possibly damaging 0.75
R7663:Pdk1 UTSW 2 71875398 splice site probably null
R8011:Pdk1 UTSW 2 71875452 missense probably benign 0.05
RF020:Pdk1 UTSW 2 71883896 missense possibly damaging 0.84
RF060:Pdk1 UTSW 2 71873445 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- AGTGTCACAGGTCCTGTCACTAGC -3'
(R):5'- GATCAAAGTCTGCCTCCAGTGTTCC -3'

Sequencing Primer
(F):5'- GTCACTAGCCCGTGCTTAG -3'
(R):5'- AGTGTTCCTTCAACCCGAATC -3'
Posted On2014-05-09