Mutagenetix > Incidental Mutation

Incidental Mutation 'R1653:Nfs1'

188837

Institutional Source

Beutler Lab

Gene Symbol

Nfs1

Ensembl Gene

ENSMUSG00000027618

Gene Name

nitrogen fixation gene 1 (S. cerevisiae)

Synonyms

m-Nfs1

MMRRC Submission

039689-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.970) question?

Stock #

R1653 (G1)

Quality Score

190

Status

Not validated

Chromosome

Chromosomal Location

156123639-156144186 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 156125336 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glycine to Aspartic acid at position 44 (G44D)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029147] [ENSMUST00000184469]

AlphaFold

Q9Z1J3

Predicted Effect

probably damaging
Transcript: ENSMUST00000029147
AA Change: V421M

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000029147
Gene: ENSMUSG00000027618
AA Change: V421M

Domain	Start	End	E-Value	Type
low complexity region	10	31	N/A	INTRINSIC
Pfam:Aminotran_5	61	424	6.2e-94	PFAM
Pfam:Beta_elim_lyase	94	344	7.8e-12	PFAM
Pfam:DegT_DnrJ_EryC1	100	250	1.8e-6	PFAM

Predicted Effect

unknown
Transcript: ENSMUST00000159952
AA Change: V67M

SMART Domains

Protein: ENSMUSP00000124101
Gene: ENSMUSG00000098950
AA Change: V67M

Domain	Start	End	E-Value	Type
SCOP:d1eg5a_	3	82	2e-15	SMART
PDB:1P3W\|A	3	86	3e-34	PDB
low complexity region	93	106	N/A	INTRINSIC
Blast:RRM_2	124	160	2e-14	BLAST

Predicted Effect

probably damaging
Transcript: ENSMUST00000160165
AA Change: G44D

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000124858
Gene: ENSMUSG00000098950
AA Change: G44D

Domain	Start	End	E-Value	Type
PDB:1P3W\|A	3	28	1e-6	PDB
low complexity region	36	50	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000162612
AA Change: V67M

SMART Domains

Protein: ENSMUSP00000125190
Gene: ENSMUSG00000098950
AA Change: V67M

Domain	Start	End	E-Value	Type
SCOP:d1eg5a_	3	82	1e-15	SMART
PDB:1P3W\|A	3	86	2e-34	PDB
low complexity region	93	106	N/A	INTRINSIC
Blast:RRM_2	124	161	1e-14	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000184469

SMART Domains

Protein: ENSMUSP00000139294
Gene: ENSMUSG00000027618

Domain	Start	End	E-Value	Type
Pfam:Aminotran_5	1	81	2.3e-10	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Iron-sulfur clusters are required for the function of many cellular enzymes. The proteins encoded by this gene supply inorganic sulfur to these clusters by removing the sulfur from cysteine, creating alanine in the process. This gene uses alternate in-frame translation initiation sites to generate mitochondrial forms and cytoplasmic/nuclear forms. Selection of the alternative initiation sites is determined by the cytosolic pH. The encoded proteins belong to the class-V family of pyridoxal phosphate-dependent aminotransferases. Alternatively spliced transcript variants have been described. [provided by RefSeq, Nov 2010]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	G	T	7: 127,384,480	H483Q	possibly damaging	Het
Adam34	A	T	8: 43,650,645	C654*	probably null	Het
Adamts19	T	A	18: 58,890,293	N253K	probably benign	Het
Adgrb3	A	G	1: 25,101,503	L1162S	probably benign	Het
Ap2b1	T	A	11: 83,346,831	Y574N	probably damaging	Het
Atrn	A	G	2: 130,935,624	I198V	probably benign	Het
Bcan	T	A	3: 87,994,196	I400F	probably damaging	Het
Capn10	A	G	1: 92,946,898	Y617C	probably damaging	Het
Capn8	A	G	1: 182,623,951	N578D	probably benign	Het
Casd1	T	C	6: 4,624,134	L309P	probably benign	Het
Ccser1	T	A	6: 61,311,465	I204K	probably benign	Het
Cd276	T	C	9: 58,537,449	T80A	probably benign	Het
Cdh3	T	C	8: 106,539,068	S248P	probably damaging	Het
Celsr2	T	C	3: 108,413,520	T659A	possibly damaging	Het
Col6a4	C	T	9: 106,072,409	V676I	probably damaging	Het
Crmp1	T	A	5: 37,286,468	V575D	probably damaging	Het
Ep400	G	A	5: 110,693,174	Q1795*	probably null	Het
Gcnt3	A	G	9: 70,035,077	C70R	probably damaging	Het
Gm12258	T	C	11: 58,858,287	I96T	possibly damaging	Het
Gpr183	A	G	14: 121,954,263	F282S	probably damaging	Het
Igfals	T	C	17: 24,881,078	V381A	probably benign	Het
Irs3	C	A	5: 137,644,521	L218F	probably damaging	Het
Kdm5b	T	C	1: 134,602,481	F410S	probably damaging	Het
Klc4	T	C	17: 46,631,859	Y593C	possibly damaging	Het
Lce1h	T	A	3: 92,763,443	Q134L	unknown	Het
Lyst	T	C	13: 13,635,226	S494P	probably damaging	Het
March3	A	G	18: 56,811,895	M42T	probably benign	Het
Myh7	A	G	14: 54,990,789	I250T	probably benign	Het
N4bp1	G	T	8: 86,844,948	H807Q	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Nrg1	C	T	8: 31,818,653	R445H	probably damaging	Het
Olfr1507	A	T	14: 52,490,772	F64Y	probably damaging	Het
Olfr299	T	C	7: 86,466,212	V267A	probably benign	Het
Olfr683	T	A	7: 105,143,870	D141V	possibly damaging	Het
Pak7	C	T	2: 136,116,887	V94M	probably damaging	Het
Pdk1	G	A	2: 71,888,995		probably null	Het
Sin3b	G	T	8: 72,741,519	V290L	probably benign	Het
Sirt1	T	C	10: 63,321,809	T609A	probably benign	Het
Skint5	A	T	4: 113,490,678	S1289T	unknown	Het
Slc32a1	A	T	2: 158,614,889	H488L	probably benign	Het
Slc35b3	A	G	13: 38,955,798	S18P	probably benign	Het
Spaca7	T	A	8: 12,586,501	I109K	possibly damaging	Het
Tmem204	A	G	17: 25,080,527	L6P	possibly damaging	Het
Tubgcp6	G	A	15: 89,107,442	R651C	probably damaging	Het
Vps13b	T	A	15: 35,607,272	L1117*	probably null	Het
Wdcp	T	C	12: 4,851,815	L557P	probably damaging	Het
Wwp2	T	C	8: 107,483,410	F140S	possibly damaging	Het
Zfp429	C	T	13: 67,389,924	R467H	possibly damaging	Het
Zfp839	T	A	12: 110,855,250	M166K	probably benign	Het
Zfyve9	G	A	4: 108,660,577	Q1106*	probably null	Het
Zrsr1	T	A	11: 22,974,158	C311S	probably damaging	Het

Other mutations in Nfs1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02318:Nfs1	APN	2	156124271	missense	probably damaging	1.00
IGL02944:Nfs1	APN	2	156127768	missense	probably damaging	1.00
IGL03350:Nfs1	APN	2	156127740	missense	probably benign	0.37
lantana	UTSW	2	156134449	missense	possibly damaging	0.94
G1Funyon:Nfs1	UTSW	2	156134493	nonsense	probably null
R0118:Nfs1	UTSW	2	156134524	missense	probably damaging	1.00
R0374:Nfs1	UTSW	2	156132660	missense	probably damaging	1.00
R3787:Nfs1	UTSW	2	156128583	missense	possibly damaging	0.53
R4614:Nfs1	UTSW	2	156144050	missense	probably benign	0.04
R4782:Nfs1	UTSW	2	156134449	missense	possibly damaging	0.94
R4799:Nfs1	UTSW	2	156134449	missense	possibly damaging	0.94
R5053:Nfs1	UTSW	2	156126398	missense	probably damaging	0.99
R5447:Nfs1	UTSW	2	156142136	missense	probably benign	0.01
R5479:Nfs1	UTSW	2	156128502	missense	probably damaging	1.00
R5992:Nfs1	UTSW	2	156134453	missense	probably damaging	0.98
R7267:Nfs1	UTSW	2	156123783	missense	probably benign	0.12
R7400:Nfs1	UTSW	2	156126323	missense	probably damaging	1.00
R7886:Nfs1	UTSW	2	156142061	missense	unknown
R8301:Nfs1	UTSW	2	156134493	nonsense	probably null
R8729:Nfs1	UTSW	2	156123807	missense	probably benign	0.20
R8905:Nfs1	UTSW	2	156128583	missense	probably damaging	0.96
R9099:Nfs1	UTSW	2	156127014	missense	probably damaging	1.00
R9417:Nfs1	UTSW	2	156123931	nonsense	probably null
R9661:Nfs1	UTSW	2	156128553	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CAGCCTACAATCCCTTTACACTCGG -3'
(R):5'- ACCTCCTGTTTACCTAGAGAGGCAC -3'

Sequencing Primer
(F):5'- GGGTTTCCGGCTGTATGAAC -3'
(R):5'- gtagccagagaatgcccc -3'

Posted On

2014-05-09