Mutagenetix > Incidental Mutation

Incidental Mutation 'R1653:Celsr2'

188842

Institutional Source

Beutler Lab

Gene Symbol

Celsr2

Ensembl Gene

ENSMUSG00000068740

Gene Name

cadherin, EGF LAG seven-pass G-type receptor 2

Synonyms

mfmi1, EGFL2, flamingo

MMRRC Submission

039689-MU

Accession Numbers

Genbank: NM_017392.3, NM_001004177.2 ; Ensembl: ENSMUST00000090558

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1653 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

108390851-108415552 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 108413520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 659 (T659A)

Ref Sequence

ENSEMBL: ENSMUSP00000088046 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000090558]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000090558
AA Change: T659A

PolyPhen 2 Score 0.518 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000088046
Gene: ENSMUSG00000068740
AA Change: T659A

Domain	Start	End	E-Value	Type
signal peptide	1	31	N/A	INTRINSIC
low complexity region	35	53	N/A	INTRINSIC
CA	203	287	1.36e-26	SMART
CA	311	397	1.33e-29	SMART
CA	421	503	2.59e-27	SMART
CA	527	608	3.33e-30	SMART
CA	632	710	5.18e-18	SMART
CA	734	813	1.08e-29	SMART
CA	837	919	8.08e-29	SMART
low complexity region	920	932	N/A	INTRINSIC
CA	943	1021	4.3e-24	SMART
CA	1049	1125	1.87e-1	SMART
low complexity region	1188	1198	N/A	INTRINSIC
EGF	1231	1286	1.81e-3	SMART
EGF_CA	1288	1324	2.24e-8	SMART
EGF	1331	1366	6.65e-2	SMART
LamG	1387	1554	8.4e-30	SMART
EGF	1577	1610	8e-5	SMART
LamG	1636	1770	1.56e-24	SMART
EGF	1796	1829	2.35e-2	SMART
EGF	1831	1867	3.88e-3	SMART
TNFR	1908	1943	1.35e-1	SMART
EGF_Lam	1924	1969	9.54e-12	SMART
HormR	1972	2034	1.57e-20	SMART
Pfam:GAIN	2046	2289	3e-62	PFAM
GPS	2315	2368	1.86e-25	SMART
Pfam:7tm_2	2373	2605	1.1e-48	PFAM
low complexity region	2715	2733	N/A	INTRINSIC
low complexity region	2857	2873	N/A	INTRINSIC
low complexity region	2874	2881	N/A	INTRINSIC

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the flamingo subfamily, part of the cadherin superfamily. The flamingo subfamily consists of nonclassic-type cadherins; a subpopulation that does not interact with catenins. The flamingo cadherins are located at the plasma membrane and have nine cadherin domains, seven epidermal growth factor-like repeats and two laminin A G-type repeats in their ectodomain. They also have seven transmembrane domains, a characteristic unique to this subfamily. It is postulated that these proteins are receptors involved in contact-mediated communication, with cadherin domains acting as homophilic binding regions and the EGF-like domains involved in cell adhesion and receptor-ligand interactions. The specific function of this particular member has not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this allele have mild to moderately dilated lateral ventricles in the brain but are otherwise normal. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(3)

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	G	T	7: 127,384,480	H483Q	possibly damaging	Het
Adam34	A	T	8: 43,650,645	C654*	probably null	Het
Adamts19	T	A	18: 58,890,293	N253K	probably benign	Het
Adgrb3	A	G	1: 25,101,503	L1162S	probably benign	Het
Ap2b1	T	A	11: 83,346,831	Y574N	probably damaging	Het
Atrn	A	G	2: 130,935,624	I198V	probably benign	Het
Bcan	T	A	3: 87,994,196	I400F	probably damaging	Het
Capn10	A	G	1: 92,946,898	Y617C	probably damaging	Het
Capn8	A	G	1: 182,623,951	N578D	probably benign	Het
Casd1	T	C	6: 4,624,134	L309P	probably benign	Het
Ccser1	T	A	6: 61,311,465	I204K	probably benign	Het
Cd276	T	C	9: 58,537,449	T80A	probably benign	Het
Cdh3	T	C	8: 106,539,068	S248P	probably damaging	Het
Col6a4	C	T	9: 106,072,409	V676I	probably damaging	Het
Crmp1	T	A	5: 37,286,468	V575D	probably damaging	Het
Ep400	G	A	5: 110,693,174	Q1795*	probably null	Het
Gcnt3	A	G	9: 70,035,077	C70R	probably damaging	Het
Gm12258	T	C	11: 58,858,287	I96T	possibly damaging	Het
Gpr183	A	G	14: 121,954,263	F282S	probably damaging	Het
Igfals	T	C	17: 24,881,078	V381A	probably benign	Het
Irs3	C	A	5: 137,644,521	L218F	probably damaging	Het
Kdm5b	T	C	1: 134,602,481	F410S	probably damaging	Het
Klc4	T	C	17: 46,631,859	Y593C	possibly damaging	Het
Lce1h	T	A	3: 92,763,443	Q134L	unknown	Het
Lyst	T	C	13: 13,635,226	S494P	probably damaging	Het
March3	A	G	18: 56,811,895	M42T	probably benign	Het
Myh7	A	G	14: 54,990,789	I250T	probably benign	Het
N4bp1	G	T	8: 86,844,948	H807Q	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Nfs1	C	T	2: 156,125,336	G44D	probably damaging	Het
Nrg1	C	T	8: 31,818,653	R445H	probably damaging	Het
Olfr1507	A	T	14: 52,490,772	F64Y	probably damaging	Het
Olfr299	T	C	7: 86,466,212	V267A	probably benign	Het
Olfr683	T	A	7: 105,143,870	D141V	possibly damaging	Het
Pak7	C	T	2: 136,116,887	V94M	probably damaging	Het
Pdk1	G	A	2: 71,888,995		probably null	Het
Sin3b	G	T	8: 72,741,519	V290L	probably benign	Het
Sirt1	T	C	10: 63,321,809	T609A	probably benign	Het
Skint5	A	T	4: 113,490,678	S1289T	unknown	Het
Slc32a1	A	T	2: 158,614,889	H488L	probably benign	Het
Slc35b3	A	G	13: 38,955,798	S18P	probably benign	Het
Spaca7	T	A	8: 12,586,501	I109K	possibly damaging	Het
Tmem204	A	G	17: 25,080,527	L6P	possibly damaging	Het
Tubgcp6	G	A	15: 89,107,442	R651C	probably damaging	Het
Vps13b	T	A	15: 35,607,272	L1117*	probably null	Het
Wdcp	T	C	12: 4,851,815	L557P	probably damaging	Het
Wwp2	T	C	8: 107,483,410	F140S	possibly damaging	Het
Zfp429	C	T	13: 67,389,924	R467H	possibly damaging	Het
Zfp839	T	A	12: 110,855,250	M166K	probably benign	Het
Zfyve9	G	A	4: 108,660,577	Q1106*	probably null	Het
Zrsr1	T	A	11: 22,974,158	C311S	probably damaging	Het

Other mutations in Celsr2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00898:Celsr2	APN	3	108413879	missense	possibly damaging	0.49
IGL01020:Celsr2	APN	3	108403270	missense	probably damaging	0.99
IGL01420:Celsr2	APN	3	108393763	missense	probably benign	0.13
IGL01448:Celsr2	APN	3	108393239	missense	probably damaging	0.99
IGL01559:Celsr2	APN	3	108406867	missense	possibly damaging	0.75
IGL01674:Celsr2	APN	3	108414843	missense	probably damaging	1.00
IGL01863:Celsr2	APN	3	108394022	missense	probably benign	0.00
IGL02309:Celsr2	APN	3	108396011	missense	probably damaging	1.00
IGL02325:Celsr2	APN	3	108412871	missense	probably damaging	1.00
IGL02409:Celsr2	APN	3	108413955	missense	probably damaging	1.00
IGL02514:Celsr2	APN	3	108397510	missense	probably benign	0.01
IGL02812:Celsr2	APN	3	108414113	missense	probably benign	0.25
IGL02894:Celsr2	APN	3	108395210	missense	probably damaging	1.00
IGL03281:Celsr2	APN	3	108412940	missense	probably damaging	1.00
barrow	UTSW	3	108394965	missense	possibly damaging	0.92
goldeneye	UTSW	3	108394919	missense	probably damaging	1.00
1mM(1):Celsr2	UTSW	3	108400838	missense	probably benign	0.01
ANU74:Celsr2	UTSW	3	108412499	missense	probably damaging	1.00
IGL02799:Celsr2	UTSW	3	108414062	missense	probably damaging	1.00
R0011:Celsr2	UTSW	3	108413402	missense	probably benign	0.19
R0031:Celsr2	UTSW	3	108413063	missense	probably damaging	1.00
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0049:Celsr2	UTSW	3	108397254	missense	probably benign	0.12
R0090:Celsr2	UTSW	3	108393327	splice site	probably benign
R0140:Celsr2	UTSW	3	108397933	missense	probably benign	0.00
R0524:Celsr2	UTSW	3	108401587	missense	probably damaging	1.00
R0607:Celsr2	UTSW	3	108403895	critical splice donor site	probably null
R0662:Celsr2	UTSW	3	108398520	missense	probably damaging	0.99
R0690:Celsr2	UTSW	3	108414977	missense	probably damaging	1.00
R0691:Celsr2	UTSW	3	108412623	missense	probably damaging	1.00
R0710:Celsr2	UTSW	3	108412712	missense	probably benign	0.42
R0730:Celsr2	UTSW	3	108398606	missense	probably damaging	1.00
R0815:Celsr2	UTSW	3	108401301	missense	possibly damaging	0.56
R0848:Celsr2	UTSW	3	108414338	missense	probably benign
R0989:Celsr2	UTSW	3	108403272	missense	probably benign	0.00
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1185:Celsr2	UTSW	3	108399709	missense	possibly damaging	0.95
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1469:Celsr2	UTSW	3	108414108	missense	probably damaging	1.00
R1474:Celsr2	UTSW	3	108393739	missense	possibly damaging	0.91
R1608:Celsr2	UTSW	3	108402483	missense	probably damaging	1.00
R1659:Celsr2	UTSW	3	108414095	missense	probably benign
R1689:Celsr2	UTSW	3	108407304	missense	possibly damaging	0.63
R1848:Celsr2	UTSW	3	108401310	missense	probably benign	0.35
R1859:Celsr2	UTSW	3	108396630	missense	probably damaging	1.00
R1918:Celsr2	UTSW	3	108398650	missense	probably benign	0.05
R1974:Celsr2	UTSW	3	108414214	missense	probably damaging	1.00
R2042:Celsr2	UTSW	3	108402495	missense	probably damaging	0.98
R2167:Celsr2	UTSW	3	108413193	missense	probably damaging	0.96
R2333:Celsr2	UTSW	3	108398605	missense	probably benign	0.16
R2434:Celsr2	UTSW	3	108404479	missense	probably damaging	1.00
R2504:Celsr2	UTSW	3	108413591	missense	probably benign	0.11
R3420:Celsr2	UTSW	3	108414416	missense	probably benign	0.03
R3712:Celsr2	UTSW	3	108400839	missense	probably benign
R3723:Celsr2	UTSW	3	108397415	splice site	probably benign
R3809:Celsr2	UTSW	3	108403239	missense	possibly damaging	0.67
R4018:Celsr2	UTSW	3	108394965	missense	possibly damaging	0.92
R4126:Celsr2	UTSW	3	108402097	missense	possibly damaging	0.71
R4177:Celsr2	UTSW	3	108413978	missense	probably damaging	0.96
R4232:Celsr2	UTSW	3	108413772	missense	probably benign	0.02
R4293:Celsr2	UTSW	3	108393677	missense	probably benign	0.01
R4458:Celsr2	UTSW	3	108394997	missense	probably damaging	0.98
R4621:Celsr2	UTSW	3	108395216	missense	possibly damaging	0.86
R4645:Celsr2	UTSW	3	108395969	missense	probably damaging	1.00
R4700:Celsr2	UTSW	3	108397231	missense	probably benign	0.24
R4732:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4733:Celsr2	UTSW	3	108398952	missense	probably damaging	0.99
R4901:Celsr2	UTSW	3	108406987	missense	possibly damaging	0.81
R4932:Celsr2	UTSW	3	108402758	missense	probably damaging	1.00
R4989:Celsr2	UTSW	3	108412629	missense	possibly damaging	0.62
R5052:Celsr2	UTSW	3	108412358	missense	probably damaging	1.00
R5093:Celsr2	UTSW	3	108413373	missense	possibly damaging	0.66
R5114:Celsr2	UTSW	3	108393996	missense	probably benign	0.05
R5120:Celsr2	UTSW	3	108393120	missense	probably benign	0.02
R5135:Celsr2	UTSW	3	108398659	missense	probably damaging	1.00
R5247:Celsr2	UTSW	3	108397630	missense	probably benign	0.34
R5381:Celsr2	UTSW	3	108402757	missense	probably damaging	1.00
R5412:Celsr2	UTSW	3	108399995	missense	probably damaging	1.00
R5445:Celsr2	UTSW	3	108392658	missense	probably benign	0.01
R5528:Celsr2	UTSW	3	108413294	missense	probably damaging	1.00
R5598:Celsr2	UTSW	3	108402803	missense	possibly damaging	0.82
R5652:Celsr2	UTSW	3	108396735	missense	probably null	0.49
R5697:Celsr2	UTSW	3	108403921	nonsense	probably null
R5718:Celsr2	UTSW	3	108393358	missense	probably benign
R5869:Celsr2	UTSW	3	108413909	missense	probably damaging	1.00
R5876:Celsr2	UTSW	3	108413943	missense	probably damaging	0.96
R6021:Celsr2	UTSW	3	108401245	missense	probably benign
R6054:Celsr2	UTSW	3	108406963	missense	possibly damaging	0.95
R6244:Celsr2	UTSW	3	108393128	missense	probably damaging	0.96
R6313:Celsr2	UTSW	3	108401214	missense	probably damaging	0.99
R6322:Celsr2	UTSW	3	108412574	missense	probably damaging	1.00
R6555:Celsr2	UTSW	3	108394919	missense	probably damaging	1.00
R6682:Celsr2	UTSW	3	108400501	critical splice donor site	probably null
R7062:Celsr2	UTSW	3	108402510	missense	possibly damaging	0.95
R7110:Celsr2	UTSW	3	108397865	missense	probably damaging	1.00
R7139:Celsr2	UTSW	3	108415359	missense	unknown
R7326:Celsr2	UTSW	3	108394995	missense	possibly damaging	0.85
R7425:Celsr2	UTSW	3	108402457	missense	probably damaging	1.00
R7452:Celsr2	UTSW	3	108413090	missense	possibly damaging	0.95
R7461:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7502:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R7613:Celsr2	UTSW	3	108395640	missense	probably damaging	1.00
R7644:Celsr2	UTSW	3	108413490	missense	probably damaging	0.99
R7666:Celsr2	UTSW	3	108398588	missense	probably benign
R7687:Celsr2	UTSW	3	108397769	missense	probably benign	0.27
R7695:Celsr2	UTSW	3	108402753	missense	probably damaging	1.00
R8002:Celsr2	UTSW	3	108403969	missense	probably damaging	1.00
R8052:Celsr2	UTSW	3	108412655	missense	probably damaging	1.00
R8283:Celsr2	UTSW	3	108396455	missense	probably damaging	1.00
R8356:Celsr2	UTSW	3	108413531	missense	possibly damaging	0.90
R8381:Celsr2	UTSW	3	108395636	missense	probably damaging	1.00
R8427:Celsr2	UTSW	3	108392633	makesense	probably null
R8435:Celsr2	UTSW	3	108414399	missense	probably benign
R8438:Celsr2	UTSW	3	108393823	missense	probably damaging	1.00
R8458:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8460:Celsr2	UTSW	3	108396777	missense	possibly damaging	0.84
R8462:Celsr2	UTSW	3	108412851	nonsense	probably null
R8479:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8480:Celsr2	UTSW	3	108398902	missense	probably benign	0.00
R8512:Celsr2	UTSW	3	108413838	missense	probably damaging	1.00
R8694:Celsr2	UTSW	3	108406860	missense	probably damaging	1.00
R8772:Celsr2	UTSW	3	108397073	missense	possibly damaging	0.84
R8843:Celsr2	UTSW	3	108396127	splice site	probably benign
R8888:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8895:Celsr2	UTSW	3	108413564	missense	possibly damaging	0.95
R8917:Celsr2	UTSW	3	108396566	missense	probably benign	0.00
R9119:Celsr2	UTSW	3	108401972	missense	possibly damaging	0.90
R9169:Celsr2	UTSW	3	108402546	missense	probably benign	0.04
R9209:Celsr2	UTSW	3	108414033	missense	probably benign	0.02
R9342:Celsr2	UTSW	3	108413126	missense	probably damaging	1.00
R9416:Celsr2	UTSW	3	108414768	missense	probably damaging	0.96
R9493:Celsr2	UTSW	3	108393758	missense	probably damaging	1.00
R9564:Celsr2	UTSW	3	108414518	missense	probably damaging	1.00
R9598:Celsr2	UTSW	3	108415262	missense	possibly damaging	0.72
R9629:Celsr2	UTSW	3	108401599	missense	probably damaging	1.00
R9691:Celsr2	UTSW	3	108394235	missense	probably damaging	1.00
X0020:Celsr2	UTSW	3	108396110	missense	probably damaging	1.00
X0050:Celsr2	UTSW	3	108401272	missense	probably benign	0.09
Z1088:Celsr2	UTSW	3	108414117	missense	probably damaging	1.00
Z1176:Celsr2	UTSW	3	108393131	missense	probably benign	0.10
Z1176:Celsr2	UTSW	3	108412341	missense	probably benign	0.07
Z1177:Celsr2	UTSW	3	108412220	missense	probably damaging	1.00
Z1177:Celsr2	UTSW	3	108413571	missense	probably benign	0.32
Z1191:Celsr2	UTSW	3	108414549	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- ATAAGACACCTGGTCCTCGTAGTCC -3'
(R):5'- CAGCCAGTGTCAGTGTAACCATCC -3'

Sequencing Primer
(F):5'- CCTCCATAAAGTAGGTGATTCGG -3'
(R):5'- GTGTCAGTGTAACCATCCTGGAC -3'

Posted On

2014-05-09