Incidental Mutation 'R1653:Ndn'
ID188851
Institutional Source Beutler Lab
Gene Symbol Ndn
Ensembl Gene ENSMUSG00000033585
Gene Namenecdin
SynonymsPeg6
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.835) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location62346569-62350262 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 62348508 bp
ZygosityHeterozygous
Amino Acid Change Proline to Leucine at position 34 (P34L)
Ref Sequence ENSEMBL: ENSMUSP00000045369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038775]
Predicted Effect probably benign
Transcript: ENSMUST00000038775
AA Change: P34L

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000045369
Gene: ENSMUSG00000033585
AA Change: P34L

DomainStartEndE-ValueType
low complexity region 85 106 N/A INTRINSIC
MAGE 109 279 5.95e-56 SMART
low complexity region 299 317 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207232
Meta Mutation Damage Score 0.1313 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This intronless gene is located in the Prader-Willi syndrome deletion region. It is an imprinted gene and is expressed exclusively from the paternal allele. Studies in mouse suggest that the protein encoded by this gene may suppress growth in postmitotic neurons. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal lethality, cyanosis and respiratory distress. Mice heterozygous for a knock-out allele exhibit abnormal behavior, abnormal nervous system morphology and physiology and, when inherited maternally, postnatal lethality with cyanosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Ndn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01512:Ndn APN 7 62348733 missense probably damaging 1.00
IGL02332:Ndn APN 7 62348825 missense probably damaging 0.98
IGL02705:Ndn APN 7 62349108 missense probably damaging 0.99
IGL02824:Ndn APN 7 62348834 missense possibly damaging 0.83
R1525:Ndn UTSW 7 62348508 missense probably benign 0.00
R1595:Ndn UTSW 7 62348508 missense probably benign 0.00
R1598:Ndn UTSW 7 62348508 missense probably benign 0.00
R1636:Ndn UTSW 7 62348508 missense probably benign 0.00
R1638:Ndn UTSW 7 62348508 missense probably benign 0.00
R1791:Ndn UTSW 7 62348508 missense probably benign 0.00
R4674:Ndn UTSW 7 62348822 missense probably damaging 1.00
R7202:Ndn UTSW 7 62348961 missense probably damaging 1.00
Z1088:Ndn UTSW 7 62349134 missense probably damaging 1.00
Z1176:Ndn UTSW 7 62348544 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGGCGCAGTGCTCAGTAAAGC -3'
(R):5'- CATGTCTGGAAACCAGAGGACCATC -3'

Sequencing Primer
(F):5'- GTGCTCAGTAAAGCGCACTTC -3'
(R):5'- TGGTCCTTCACCAACACG -3'
Posted On2014-05-09