Mutagenetix > Incidental Mutations

Incidental Mutation 'R1653:Olfr299'

188852

Institutional Source

Beutler Lab

Gene Symbol

Olfr299

Ensembl Gene

ENSMUSG00000020168

Gene Name

olfactory receptor 299

Synonyms

GA_x6K02T2NHDJ-9643949-9642957, MOR221-2

MMRRC Submission

039689-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.099) question?

Stock #

R1653 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

86459921-86469557 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 86466212 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 267 (V267A)

Ref Sequence

ENSEMBL: ENSMUSP00000149038 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000057734] [ENSMUST00000217253]

Predicted Effect

probably benign
Transcript: ENSMUST00000057734
AA Change: V267A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000062434
Gene: ENSMUSG00000020168
AA Change: V267A

Domain	Start	End	E-Value	Type
Pfam:7tm_4	29	307	4.7e-46	PFAM
Pfam:7tm_1	39	289	4.7e-21	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000217253
AA Change: V267A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	G	T	7: 127,384,480	H483Q	possibly damaging	Het
Adam34	A	T	8: 43,650,645	C654*	probably null	Het
Adamts19	T	A	18: 58,890,293	N253K	probably benign	Het
Adgrb3	A	G	1: 25,101,503	L1162S	probably benign	Het
Ap2b1	T	A	11: 83,346,831	Y574N	probably damaging	Het
Atrn	A	G	2: 130,935,624	I198V	probably benign	Het
Bcan	T	A	3: 87,994,196	I400F	probably damaging	Het
Capn10	A	G	1: 92,946,898	Y617C	probably damaging	Het
Capn8	A	G	1: 182,623,951	N578D	probably benign	Het
Casd1	T	C	6: 4,624,134	L309P	probably benign	Het
Ccser1	T	A	6: 61,311,465	I204K	probably benign	Het
Cd276	T	C	9: 58,537,449	T80A	probably benign	Het
Cdh3	T	C	8: 106,539,068	S248P	probably damaging	Het
Celsr2	T	C	3: 108,413,520	T659A	possibly damaging	Het
Col6a4	C	T	9: 106,072,409	V676I	probably damaging	Het
Crmp1	T	A	5: 37,286,468	V575D	probably damaging	Het
Ep400	G	A	5: 110,693,174	Q1795*	probably null	Het
Gcnt3	A	G	9: 70,035,077	C70R	probably damaging	Het
Gm12258	T	C	11: 58,858,287	I96T	possibly damaging	Het
Gpr183	A	G	14: 121,954,263	F282S	probably damaging	Het
Igfals	T	C	17: 24,881,078	V381A	probably benign	Het
Irs3	C	A	5: 137,644,521	L218F	probably damaging	Het
Kdm5b	T	C	1: 134,602,481	F410S	probably damaging	Het
Klc4	T	C	17: 46,631,859	Y593C	possibly damaging	Het
Lce1h	T	A	3: 92,763,443	Q134L	unknown	Het
Lyst	T	C	13: 13,635,226	S494P	probably damaging	Het
March3	A	G	18: 56,811,895	M42T	probably benign	Het
Myh7	A	G	14: 54,990,789	I250T	probably benign	Het
N4bp1	G	T	8: 86,844,948	H807Q	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Nfs1	C	T	2: 156,125,336	G44D	probably damaging	Het
Nrg1	C	T	8: 31,818,653	R445H	probably damaging	Het
Olfr1507	A	T	14: 52,490,772	F64Y	probably damaging	Het
Olfr683	T	A	7: 105,143,870	D141V	possibly damaging	Het
Pak7	C	T	2: 136,116,887	V94M	probably damaging	Het
Pdk1	G	A	2: 71,888,995		probably null	Het
Sin3b	G	T	8: 72,741,519	V290L	probably benign	Het
Sirt1	T	C	10: 63,321,809	T609A	probably benign	Het
Skint5	A	T	4: 113,490,678	S1289T	unknown	Het
Slc32a1	A	T	2: 158,614,889	H488L	probably benign	Het
Slc35b3	A	G	13: 38,955,798	S18P	probably benign	Het
Spaca7	T	A	8: 12,586,501	I109K	possibly damaging	Het
Tmem204	A	G	17: 25,080,527	L6P	possibly damaging	Het
Tubgcp6	G	A	15: 89,107,442	R651C	probably damaging	Het
Vps13b	T	A	15: 35,607,272	L1117*	probably null	Het
Wdcp	T	C	12: 4,851,815	L557P	probably damaging	Het
Wwp2	T	C	8: 107,483,410	F140S	possibly damaging	Het
Zfp429	C	T	13: 67,389,924	R467H	possibly damaging	Het
Zfp839	T	A	12: 110,855,250	M166K	probably benign	Het
Zfyve9	G	A	4: 108,660,577	Q1106*	probably null	Het
Zrsr1	T	A	11: 22,974,158	C311S	probably damaging	Het

Other mutations in Olfr299

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Olfr299	APN	7	86466272	missense	probably damaging	1.00
R1300:Olfr299	UTSW	7	86465743	missense	probably benign
R1580:Olfr299	UTSW	7	86465450	missense	probably benign	0.00
R2183:Olfr299	UTSW	7	86466386	missense	probably benign
R2190:Olfr299	UTSW	7	86466365	missense	possibly damaging	0.78
R4839:Olfr299	UTSW	7	86465909	missense	probably damaging	1.00
R5405:Olfr299	UTSW	7	86466175	missense	probably damaging	1.00
R6458:Olfr299	UTSW	7	86465680	missense	probably damaging	0.99
R6783:Olfr299	UTSW	7	86465627	missense	probably damaging	0.99
R6902:Olfr299	UTSW	7	86465787	nonsense	probably null
R7449:Olfr299	UTSW	7	86465855	missense	probably benign	0.32
R8217:Olfr299	UTSW	7	86466182	missense	probably damaging	1.00
X0050:Olfr299	UTSW	7	86465603	missense	possibly damaging	0.91
Z1088:Olfr299	UTSW	7	86465746	missense	possibly damaging	0.52

Predicted Primers

PCR Primer
(F):5'- GCACACTTTCAAAACTTTCCAACTGTCC -3'
(R):5'- AGTGGTGGTCATAGTAGTGGTCGtag -3'

Sequencing Primer
(F):5'- GTCACTCTAATGTGGTTCCTCAG -3'
(R):5'- tgtgtgtgtgcctgtgtg -3'

Posted On

2014-05-09