Incidental Mutation 'R1653:Olfr299'
ID 188852
Institutional Source Beutler Lab
Gene Symbol Olfr299
Ensembl Gene ENSMUSG00000020168
Gene Name olfactory receptor 299
Synonyms GA_x6K02T2NHDJ-9643949-9642957, MOR221-2
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock # R1653 (G1)
Quality Score 225
Status Not validated
Chromosome 7
Chromosomal Location 86459921-86469557 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86466212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 267 (V267A)
Ref Sequence ENSEMBL: ENSMUSP00000149038 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057734] [ENSMUST00000217253]
AlphaFold Q7TS05
Predicted Effect probably benign
Transcript: ENSMUST00000057734
AA Change: V267A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000062434
Gene: ENSMUSG00000020168
AA Change: V267A

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 4.7e-46 PFAM
Pfam:7tm_1 39 289 4.7e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217253
AA Change: V267A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Olfr299
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Olfr299 APN 7 86466272 missense probably damaging 1.00
R1300:Olfr299 UTSW 7 86465743 missense probably benign
R1580:Olfr299 UTSW 7 86465450 missense probably benign 0.00
R2183:Olfr299 UTSW 7 86466386 missense probably benign
R2190:Olfr299 UTSW 7 86466365 missense possibly damaging 0.78
R4839:Olfr299 UTSW 7 86465909 missense probably damaging 1.00
R5405:Olfr299 UTSW 7 86466175 missense probably damaging 1.00
R6458:Olfr299 UTSW 7 86465680 missense probably damaging 0.99
R6783:Olfr299 UTSW 7 86465627 missense probably damaging 0.99
R6902:Olfr299 UTSW 7 86465787 nonsense probably null
R7449:Olfr299 UTSW 7 86465855 missense probably benign 0.32
R8217:Olfr299 UTSW 7 86466182 missense probably damaging 1.00
R9165:Olfr299 UTSW 7 86465617 missense probably benign 0.25
X0050:Olfr299 UTSW 7 86465603 missense possibly damaging 0.91
Z1088:Olfr299 UTSW 7 86465746 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- GCACACTTTCAAAACTTTCCAACTGTCC -3'
(R):5'- AGTGGTGGTCATAGTAGTGGTCGtag -3'

Sequencing Primer
(F):5'- GTCACTCTAATGTGGTTCCTCAG -3'
(R):5'- tgtgtgtgtgcctgtgtg -3'
Posted On 2014-05-09