Incidental Mutation 'R1653:Wwp2'
ID188862
Institutional Source Beutler Lab
Gene Symbol Wwp2
Ensembl Gene ENSMUSG00000031930
Gene NameWW domain containing E3 ubiquitin protein ligase 2
SynonymsAIP2, 1300010O06Rik
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.681) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location107436365-107558595 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 107483410 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 140 (F140S)
Ref Sequence ENSEMBL: ENSMUSP00000132224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000166615] [ENSMUST00000212205]
Predicted Effect possibly damaging
Transcript: ENSMUST00000166615
AA Change: F140S

PolyPhen 2 Score 0.491 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000132224
Gene: ENSMUSG00000031930
AA Change: F140S

DomainStartEndE-ValueType
C2 19 115 1.52e-6 SMART
low complexity region 188 208 N/A INTRINSIC
low complexity region 237 249 N/A INTRINSIC
WW 301 330 4.61e-8 SMART
WW 331 363 4.33e-13 SMART
WW 406 437 2.86e-13 SMART
WW 445 477 3.6e-10 SMART
HECTc 534 870 3.24e-201 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212063
Predicted Effect probably benign
Transcript: ENSMUST00000212205
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212645
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212906
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Nedd4 family of E3 ligases, which play an important role in protein ubiquitination. The encoded protein contains four WW domains and may play a role in multiple processes including chondrogenesis and the regulation of oncogenic signaling pathways via interactions with Smad proteins and the tumor suppressor PTEN. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 10. [provided by RefSeq, Jul 2012]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit decreased body size, domed skull, short snout, twisted snout and overgrown mandibular incisors. Mice homozygous for a different knock-out allele exhibit increased sensitivity to pIpC-treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Wwp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01383:Wwp2 APN 8 107533291 critical splice donor site probably null
IGL01411:Wwp2 APN 8 107506345 missense probably benign 0.07
IGL01503:Wwp2 APN 8 107549781 missense probably damaging 0.97
IGL01543:Wwp2 APN 8 107483368 missense probably damaging 1.00
IGL01998:Wwp2 APN 8 107549521 missense probably damaging 1.00
IGL02020:Wwp2 APN 8 107556495 missense probably damaging 1.00
IGL02089:Wwp2 APN 8 107554057 missense probably damaging 1.00
IGL02131:Wwp2 APN 8 107552318 missense probably damaging 0.99
IGL02352:Wwp2 APN 8 107540646 nonsense probably null
IGL02359:Wwp2 APN 8 107540646 nonsense probably null
IGL02419:Wwp2 APN 8 107549815 missense probably damaging 1.00
IGL02528:Wwp2 APN 8 107554467 missense probably benign 0.06
R0639:Wwp2 UTSW 8 107517946 missense probably benign 0.01
R0834:Wwp2 UTSW 8 107556796 splice site probably benign
R1573:Wwp2 UTSW 8 107548489 missense probably damaging 1.00
R1782:Wwp2 UTSW 8 107506399 frame shift probably null
R1941:Wwp2 UTSW 8 107517915 missense probably benign
R2483:Wwp2 UTSW 8 107548535 missense probably damaging 1.00
R4014:Wwp2 UTSW 8 107485621 missense probably benign 0.03
R4118:Wwp2 UTSW 8 107545459 missense probably benign 0.00
R4402:Wwp2 UTSW 8 107457978 missense probably benign 0.08
R5042:Wwp2 UTSW 8 107548485 missense possibly damaging 0.95
R5117:Wwp2 UTSW 8 107554062 missense possibly damaging 0.86
R5413:Wwp2 UTSW 8 107555078 missense probably damaging 1.00
R6175:Wwp2 UTSW 8 107483407 missense possibly damaging 0.95
R6232:Wwp2 UTSW 8 107506345 missense probably benign 0.03
R6323:Wwp2 UTSW 8 107540671 missense probably damaging 1.00
R6759:Wwp2 UTSW 8 107540682 missense probably damaging 1.00
R6941:Wwp2 UTSW 8 107548502 missense probably damaging 1.00
R7043:Wwp2 UTSW 8 107457900 missense probably benign 0.00
R7109:Wwp2 UTSW 8 107483356 missense probably benign 0.28
R7457:Wwp2 UTSW 8 107517960 missense probably benign 0.05
R8027:Wwp2 UTSW 8 107555477 missense probably damaging 1.00
R8704:Wwp2 UTSW 8 107485596 missense probably benign
R8796:Wwp2 UTSW 8 107556557 missense probably null 1.00
R8844:Wwp2 UTSW 8 107483416 missense probably damaging 1.00
X0066:Wwp2 UTSW 8 107518023 missense probably benign
Z1088:Wwp2 UTSW 8 107555087 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAGCATTGCCATTCAGCACACC -3'
(R):5'- GGCCGCTAAAGAGTCTCTAACCAAG -3'

Sequencing Primer
(F):5'- TTTCACAAGACATTAGAAAGGGC -3'
(R):5'- GTCTCTAACCAAGATGCCTAGCAG -3'
Posted On2014-05-09