Incidental Mutation 'R1653:Cd276'
ID 188863
Institutional Source Beutler Lab
Gene Symbol Cd276
Ensembl Gene ENSMUSG00000035914
Gene Name CD276 antigen
Synonyms B7-H3, B7h3, 6030411F23Rik, B7RP-2
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock # R1653 (G1)
Quality Score 153
Status Not validated
Chromosome 9
Chromosomal Location 58524298-58555437 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 58537449 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 80 (T80A)
Ref Sequence ENSEMBL: ENSMUSP00000129418 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039788] [ENSMUST00000165365]
AlphaFold Q8VE98
Predicted Effect probably benign
Transcript: ENSMUST00000039788
AA Change: T80A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000042681
Gene: ENSMUSG00000035914
AA Change: T80A

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
IG 35 139 6.81e-6 SMART
IG_like 156 227 2.85e-2 SMART
transmembrane domain 248 270 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165365
AA Change: T80A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129418
Gene: ENSMUSG00000035914
AA Change: T80A

DomainStartEndE-ValueType
IG 35 139 6.81e-6 SMART
IG_like 156 227 2.85e-2 SMART
transmembrane domain 248 270 N/A INTRINSIC
low complexity region 279 294 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000213722
AA Change: T8A
Predicted Effect probably benign
Transcript: ENSMUST00000216629
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the immunoglobulin superfamily, and thought to participate in the regulation of T-cell-mediated immune response. Studies show that while the transcript of this gene is ubiquitously expressed in normal tissues and solid tumors, the protein is preferentially expressed only in tumor tissues. Additionally, it was observed that the 3' UTR of this transcript contains a target site for miR29 microRNA, and there is an inverse correlation between the expression of this protein and miR29 levels, suggesting regulation of expression of this gene product by miR29. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Inactivation of this locus results in abnormal T helper 1 physiology. Mutant mice have an increased susceptibility to inflammation and autoimmunity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Cd276
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02797:Cd276 APN 9 58537436 missense possibly damaging 0.92
R0504:Cd276 UTSW 9 58540678 missense possibly damaging 0.72
R1585:Cd276 UTSW 9 58535555 missense probably damaging 1.00
R1806:Cd276 UTSW 9 58527562 splice site probably benign
R2903:Cd276 UTSW 9 58537320 missense probably benign 0.06
R7073:Cd276 UTSW 9 58537332 missense probably damaging 0.98
R7448:Cd276 UTSW 9 58535612 missense probably benign 0.07
R7701:Cd276 UTSW 9 58535527 missense probably benign 0.12
R7894:Cd276 UTSW 9 58537479 missense possibly damaging 0.46
R7936:Cd276 UTSW 9 58540830 unclassified probably benign
R8195:Cd276 UTSW 9 58537472 missense probably damaging 1.00
RF039:Cd276 UTSW 9 58535504 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTGTCAAAGTCCTGGATGCTCAC -3'
(R):5'- TCTGAGCCTCTGACCTGAAAGGAAG -3'

Sequencing Primer
(F):5'- GTCCTGGATGCTCACAAAGC -3'
(R):5'- GAGGAAACCTCATCTTTCCTAACTG -3'
Posted On 2014-05-09