Incidental Mutation 'R1653:Zrsr1'
ID 188869
Institutional Source Beutler Lab
Gene Symbol Zrsr1
Ensembl Gene ENSMUSG00000044068
Gene Name zinc finger (CCCH type), RNA binding motif and serine/arginine rich 1
Synonyms 35kDa, U2afbp-rs, SP2, Irlgs2, U2af1-rs1, D11Ncvs75
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R1653 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 22972005-22976496 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 22974158 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Cysteine to Serine at position 311 (C311S)
Ref Sequence ENSEMBL: ENSMUSP00000062025 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049506] [ENSMUST00000057843] [ENSMUST00000071068] [ENSMUST00000159081] [ENSMUST00000160826]
AlphaFold Q64707
Predicted Effect probably damaging
Transcript: ENSMUST00000049506
AA Change: C311S

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062025
Gene: ENSMUSG00000044068
AA Change: C311S

DomainStartEndE-ValueType
low complexity region 14 39 N/A INTRINSIC
coiled coil region 52 144 N/A INTRINSIC
ZnF_C3H1 158 184 1.69e-3 SMART
RRM 190 291 1.44e-2 SMART
ZnF_C3H1 297 323 1.2e-3 SMART
low complexity region 364 389 N/A INTRINSIC
low complexity region 403 418 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000057843
SMART Domains Protein: ENSMUSP00000053606
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:HCaRG 44 238 1.2e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000071068
SMART Domains Protein: ENSMUSP00000065079
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
Pfam:HCaRG 57 89 2.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093270
SMART Domains Protein: ENSMUSP00000090958
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
Pfam:HCaRG 3 137 1.7e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159081
SMART Domains Protein: ENSMUSP00000124719
Gene: ENSMUSG00000051355

DomainStartEndE-ValueType
Pfam:HCaRG 12 184 1.3e-53 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160826
SMART Domains Protein: ENSMUSP00000125609
Gene: ENSMUSG00000098650

DomainStartEndE-ValueType
Pfam:HCaRG 1 99 1.3e-36 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162924
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229075
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230879
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Heterozygotes for a targeted null mutation of this imprinted gene are viable and fertile regardless of the parental origin of the mutated allele. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Other mutations in Zrsr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01354:Zrsr1 APN 11 22974190 missense probably damaging 1.00
R1474:Zrsr1 UTSW 11 22974404 missense probably benign
R1766:Zrsr1 UTSW 11 22973637 missense probably benign 0.00
R4884:Zrsr1 UTSW 11 22973805 missense possibly damaging 0.68
R7223:Zrsr1 UTSW 11 22973388 missense probably benign 0.00
R7417:Zrsr1 UTSW 11 22974662 splice site probably null
R7431:Zrsr1 UTSW 11 22973580 missense probably benign 0.44
R7736:Zrsr1 UTSW 11 22973510 nonsense probably null
R7751:Zrsr1 UTSW 11 22973595 missense possibly damaging 0.72
R8762:Zrsr1 UTSW 11 22973694 missense probably benign 0.02
R9621:Zrsr1 UTSW 11 22973418 missense possibly damaging 0.53
Predicted Primers PCR Primer
(F):5'- AAGTAAGCTGCAACCTGGAACCTC -3'
(R):5'- ATGAACTCCCTTGCCAAGCCTG -3'

Sequencing Primer
(F):5'- TGCAACCTGGAACCTCATCTG -3'
(R):5'- AACCAGAGTGGTAGCTTCTTGAC -3'
Posted On 2014-05-09