Incidental Mutation 'R1653:Zfp429'
ID 188877
Institutional Source Beutler Lab
Gene Symbol Zfp429
Ensembl Gene ENSMUSG00000078994
Gene Name zinc finger protein 429
Synonyms 2810487A22Rik
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1653 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 67387905-67399819 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 67389924 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Arginine to Histidine at position 467 (R467H)
Ref Sequence ENSEMBL: ENSMUSP00000105354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109732] [ENSMUST00000181071] [ENSMUST00000224684] [ENSMUST00000224825]
AlphaFold Q7M6Y0
Predicted Effect possibly damaging
Transcript: ENSMUST00000109732
AA Change: R467H

PolyPhen 2 Score 0.872 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105354
Gene: ENSMUSG00000078994
AA Change: R467H

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
ZnF_C2H2 119 141 5.12e1 SMART
ZnF_C2H2 147 169 2.27e-4 SMART
ZnF_C2H2 175 197 1.28e-3 SMART
ZnF_C2H2 203 225 1.56e-2 SMART
ZnF_C2H2 259 281 4.62e1 SMART
ZnF_C2H2 287 309 5.14e-3 SMART
ZnF_C2H2 315 337 6.78e-3 SMART
ZnF_C2H2 343 365 3.11e-2 SMART
ZnF_C2H2 371 393 1.25e-1 SMART
ZnF_C2H2 399 421 6.32e-3 SMART
ZnF_C2H2 427 449 1.47e-3 SMART
ZnF_C2H2 455 477 5.42e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000181071
SMART Domains Protein: ENSMUSP00000137755
Gene: ENSMUSG00000078994

DomainStartEndE-ValueType
KRAB 15 75 7.16e-34 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000224684
Predicted Effect probably benign
Transcript: ENSMUST00000224825
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225810
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Zfp429
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01160:Zfp429 APN 13 67391013 missense probably damaging 0.96
IGL01913:Zfp429 APN 13 67396674 missense probably damaging 1.00
IGL02343:Zfp429 APN 13 67390725 missense probably damaging 0.98
IGL02679:Zfp429 APN 13 67399736 intron probably benign
IGL03396:Zfp429 APN 13 67396040 splice site probably benign
FR4342:Zfp429 UTSW 13 67396650 missense probably benign 0.02
R0012:Zfp429 UTSW 13 67390677 missense probably benign 0.01
R1232:Zfp429 UTSW 13 67390632 missense possibly damaging 0.47
R1330:Zfp429 UTSW 13 67396143 splice site probably null
R1761:Zfp429 UTSW 13 67396076 missense probably benign 0.28
R1813:Zfp429 UTSW 13 67390386 missense possibly damaging 0.55
R2356:Zfp429 UTSW 13 67390627 missense probably benign
R4280:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4283:Zfp429 UTSW 13 67390795 missense probably damaging 1.00
R4464:Zfp429 UTSW 13 67390498 missense probably benign 0.13
R4789:Zfp429 UTSW 13 67390404 missense probably benign 0.06
R5187:Zfp429 UTSW 13 67390840 missense probably damaging 0.99
R5250:Zfp429 UTSW 13 67390519 missense probably benign 0.00
R6688:Zfp429 UTSW 13 67396130 missense probably damaging 0.98
R6772:Zfp429 UTSW 13 67390198 missense probably damaging 1.00
R6989:Zfp429 UTSW 13 67389961 missense probably benign 0.00
R7041:Zfp429 UTSW 13 67390711 missense probably damaging 1.00
R7101:Zfp429 UTSW 13 67390812 missense possibly damaging 0.88
R7593:Zfp429 UTSW 13 67390291 missense probably damaging 1.00
R7792:Zfp429 UTSW 13 67390439 nonsense probably null
R8500:Zfp429 UTSW 13 67390709 nonsense probably null
R8721:Zfp429 UTSW 13 67390212 missense probably damaging 0.98
R8891:Zfp429 UTSW 13 67390711 missense probably damaging 1.00
R9364:Zfp429 UTSW 13 67390412 missense probably benign 0.12
R9554:Zfp429 UTSW 13 67390412 missense probably benign 0.12
Predicted Primers PCR Primer
(F):5'- GGATGAACTGTCATGTGTCGATCAGG -3'
(R):5'- ACAAACCCTACAAGTGTGAAGACTGTG -3'

Sequencing Primer
(F):5'- GTCATGTGTCGATCAGGCTATAAC -3'
(R):5'- GGCAGATGTTTCTGCTCATCC -3'
Posted On 2014-05-09