Incidental Mutation 'R1653:Gpr183'
ID188881
Institutional Source Beutler Lab
Gene Symbol Gpr183
Ensembl Gene ENSMUSG00000051212
Gene NameG protein-coupled receptor 183
SynonymsEbi2
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location121952551-121965195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121954263 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 282 (F282S)
Ref Sequence ENSEMBL: ENSMUSP00000052404 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039803] [ENSMUST00000049872] [ENSMUST00000226998] [ENSMUST00000227267]
Predicted Effect probably benign
Transcript: ENSMUST00000039803
SMART Domains Protein: ENSMUSP00000043245
Gene: ENSMUSG00000041765

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 92 114 N/A INTRINSIC
transmembrane domain 129 151 N/A INTRINSIC
transmembrane domain 164 186 N/A INTRINSIC
low complexity region 261 269 N/A INTRINSIC
UBA 307 344 1.11e-12 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000049872
AA Change: F282S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052404
Gene: ENSMUSG00000051212
AA Change: F282S

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 35 167 4.6e-9 PFAM
Pfam:7TM_GPCR_Srsx 38 319 4e-10 PFAM
Pfam:7tm_1 44 304 1.4e-47 PFAM
low complexity region 323 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000226998
Predicted Effect probably benign
Transcript: ENSMUST00000227267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227684
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227936
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by the up-regulation of its expression upon Epstein-Barr virus infection of primary B lymphocytes. This gene is predicted to encode a G protein-coupled receptor that is most closely related to the thrombin receptor. Expression of this gene was detected in B-lymphocyte cell lines and lymphoid tissues but not in T-lymphocyte cell lines or peripheral blood T lymphocytes. The function of this gene is unknown. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to altered B cell migration during immune activation. Mice homozygous for a null allele exhibit decreased plasmacytoid and myeloid dendritic cell number, and increased type I interferon responses upon TLR ligand challenge or viral infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Klc4 T C 17: 46,631,859 Y593C possibly damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Gpr183
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1856:Gpr183 UTSW 14 121954741 missense probably benign 0.01
R2186:Gpr183 UTSW 14 121954315 missense probably benign 0.00
R2422:Gpr183 UTSW 14 121954177 missense probably damaging 1.00
R4630:Gpr183 UTSW 14 121954849 missense probably damaging 1.00
R4630:Gpr183 UTSW 14 121954850 nonsense probably null
R4670:Gpr183 UTSW 14 121954737 missense probably damaging 1.00
R4671:Gpr183 UTSW 14 121954737 missense probably damaging 1.00
R4976:Gpr183 UTSW 14 121954863 missense possibly damaging 0.88
R5119:Gpr183 UTSW 14 121954863 missense possibly damaging 0.88
R5382:Gpr183 UTSW 14 121954921 missense possibly damaging 0.95
R6952:Gpr183 UTSW 14 121954485 missense possibly damaging 0.62
R7426:Gpr183 UTSW 14 121954744 missense possibly damaging 0.69
R7682:Gpr183 UTSW 14 121954740 missense possibly damaging 0.50
R7722:Gpr183 UTSW 14 121954858 missense probably damaging 0.98
S24628:Gpr183 UTSW 14 121954476 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTCTCTTCAGGGGCTGACCTCAC -3'
(R):5'- ACGTGCTGCCTATCACAGTCATTC -3'

Sequencing Primer
(F):5'- ACTGCGCTGGAGATCGAC -3'
(R):5'- GCTGCAAACTCTTCAGGACTG -3'
Posted On2014-05-09