Mutagenetix > Incidental Mutation

Incidental Mutation 'R1653:Igfals'

188884

Institutional Source

Beutler Lab

Gene Symbol

Igfals

Ensembl Gene

ENSMUSG00000046070

Gene Name

insulin-like growth factor binding protein, acid labile subunit

Synonyms

ALS, Albs

MMRRC Submission

039689-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1653 (G1)

Quality Score

117

Status

Not validated

Chromosome

Chromosomal Location

24878770-24882008 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24881078 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 381 (V381A)

Ref Sequence

ENSEMBL: ENSMUSP00000060169 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000044252] [ENSMUST00000050714]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000044252

SMART Domains

Protein: ENSMUSP00000049319
Gene: ENSMUSG00000039183

Domain	Start	End	E-Value	Type
Pfam:ParA	16	267	3.2e-99	PFAM
Pfam:ArsA_ATPase	19	66	1.7e-8	PFAM
Pfam:AAA_31	19	79	1.5e-8	PFAM
Pfam:MipZ	19	155	2.1e-10	PFAM
Pfam:CbiA	21	199	2.2e-19	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000050714
AA Change: V381A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000060169
Gene: ENSMUSG00000046070
AA Change: V381A

Domain	Start	End	E-Value	Type
signal peptide	1	25	N/A	INTRINSIC
LRRNT	40	78	9.37e-10	SMART
LRR	77	96	1.62e1	SMART
LRR	97	120	1.41e1	SMART
LRR_TYP	121	144	6.78e-3	SMART
LRR	145	168	1.03e1	SMART
LRR_TYP	169	192	1.1e-2	SMART
LRR	193	216	2.17e-1	SMART
LRR_TYP	217	240	2.4e-3	SMART
LRR_TYP	241	264	1.82e-3	SMART
LRR	265	288	5.72e-1	SMART
LRR_TYP	289	312	6.23e-2	SMART
LRR_TYP	313	336	6.32e-3	SMART
LRR_TYP	337	360	2.2e-2	SMART
LRR	361	384	1.89e-1	SMART
LRR	385	408	3.87e1	SMART
LRR	409	432	2.67e-1	SMART
LRR_TYP	433	456	1.06e-4	SMART
LRR_TYP	457	480	6.78e-3	SMART
LRR	481	504	1.09e2	SMART
LRR	505	530	2.68e1	SMART
LRRCT	535	582	5.11e-8	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.4%
20x: 92.7%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serum protein that binds insulin-like growth factors, increasing their half-life and their vascular localization. Production of the encoded protein, which contains twenty leucine-rich repeats, is stimulated by growth hormone. Defects in this gene are a cause of acid-labile subunit deficiency, which maifests itself in a delayed and slow puberty. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for disruptions in this gene gain weight more slowly after birth and display less growth in long bones. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
9130019O22Rik	G	T	7: 127,384,480	H483Q	possibly damaging	Het
Adam34	A	T	8: 43,650,645	C654*	probably null	Het
Adamts19	T	A	18: 58,890,293	N253K	probably benign	Het
Adgrb3	A	G	1: 25,101,503	L1162S	probably benign	Het
Ap2b1	T	A	11: 83,346,831	Y574N	probably damaging	Het
Atrn	A	G	2: 130,935,624	I198V	probably benign	Het
Bcan	T	A	3: 87,994,196	I400F	probably damaging	Het
Capn10	A	G	1: 92,946,898	Y617C	probably damaging	Het
Capn8	A	G	1: 182,623,951	N578D	probably benign	Het
Casd1	T	C	6: 4,624,134	L309P	probably benign	Het
Ccser1	T	A	6: 61,311,465	I204K	probably benign	Het
Cd276	T	C	9: 58,537,449	T80A	probably benign	Het
Cdh3	T	C	8: 106,539,068	S248P	probably damaging	Het
Celsr2	T	C	3: 108,413,520	T659A	possibly damaging	Het
Col6a4	C	T	9: 106,072,409	V676I	probably damaging	Het
Crmp1	T	A	5: 37,286,468	V575D	probably damaging	Het
Ep400	G	A	5: 110,693,174	Q1795*	probably null	Het
Gcnt3	A	G	9: 70,035,077	C70R	probably damaging	Het
Gm12258	T	C	11: 58,858,287	I96T	possibly damaging	Het
Gpr183	A	G	14: 121,954,263	F282S	probably damaging	Het
Irs3	C	A	5: 137,644,521	L218F	probably damaging	Het
Kdm5b	T	C	1: 134,602,481	F410S	probably damaging	Het
Klc4	T	C	17: 46,631,859	Y593C	possibly damaging	Het
Lce1h	T	A	3: 92,763,443	Q134L	unknown	Het
Lyst	T	C	13: 13,635,226	S494P	probably damaging	Het
March3	A	G	18: 56,811,895	M42T	probably benign	Het
Myh7	A	G	14: 54,990,789	I250T	probably benign	Het
N4bp1	G	T	8: 86,844,948	H807Q	probably benign	Het
Ndn	C	T	7: 62,348,508	P34L	probably benign	Het
Nfs1	C	T	2: 156,125,336	G44D	probably damaging	Het
Nrg1	C	T	8: 31,818,653	R445H	probably damaging	Het
Olfr1507	A	T	14: 52,490,772	F64Y	probably damaging	Het
Olfr299	T	C	7: 86,466,212	V267A	probably benign	Het
Olfr683	T	A	7: 105,143,870	D141V	possibly damaging	Het
Pak7	C	T	2: 136,116,887	V94M	probably damaging	Het
Pdk1	G	A	2: 71,888,995		probably null	Het
Sin3b	G	T	8: 72,741,519	V290L	probably benign	Het
Sirt1	T	C	10: 63,321,809	T609A	probably benign	Het
Skint5	A	T	4: 113,490,678	S1289T	unknown	Het
Slc32a1	A	T	2: 158,614,889	H488L	probably benign	Het
Slc35b3	A	G	13: 38,955,798	S18P	probably benign	Het
Spaca7	T	A	8: 12,586,501	I109K	possibly damaging	Het
Tmem204	A	G	17: 25,080,527	L6P	possibly damaging	Het
Tubgcp6	G	A	15: 89,107,442	R651C	probably damaging	Het
Vps13b	T	A	15: 35,607,272	L1117*	probably null	Het
Wdcp	T	C	12: 4,851,815	L557P	probably damaging	Het
Wwp2	T	C	8: 107,483,410	F140S	possibly damaging	Het
Zfp429	C	T	13: 67,389,924	R467H	possibly damaging	Het
Zfp839	T	A	12: 110,855,250	M166K	probably benign	Het
Zfyve9	G	A	4: 108,660,577	Q1106*	probably null	Het
Zrsr1	T	A	11: 22,974,158	C311S	probably damaging	Het

Other mutations in Igfals

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01085:Igfals	APN	17	24881660	missense	probably benign	0.08
IGL01796:Igfals	APN	17	24880082	missense	probably damaging	0.96
IGL02448:Igfals	APN	17	24880187	missense	probably damaging	1.00
R1022:Igfals	UTSW	17	24880483	missense	probably damaging	0.99
R1024:Igfals	UTSW	17	24880483	missense	probably damaging	0.99
R1127:Igfals	UTSW	17	24880481	missense	probably damaging	1.00
R1827:Igfals	UTSW	17	24880304	missense	probably benign	0.20
R3872:Igfals	UTSW	17	24881605	missense	possibly damaging	0.88
R3873:Igfals	UTSW	17	24881605	missense	possibly damaging	0.88
R3874:Igfals	UTSW	17	24881605	missense	possibly damaging	0.88
R4278:Igfals	UTSW	17	24881217	missense	probably benign	0.01
R5360:Igfals	UTSW	17	24880093	missense	probably benign	0.00
R5417:Igfals	UTSW	17	24880316	missense	probably damaging	1.00
R5654:Igfals	UTSW	17	24881465	missense	probably benign	0.23
R6261:Igfals	UTSW	17	24881365	missense	possibly damaging	0.88
R7061:Igfals	UTSW	17	24880307	missense	probably damaging	1.00
R7223:Igfals	UTSW	17	24881234	missense	probably damaging	1.00
R7484:Igfals	UTSW	17	24879988	missense	possibly damaging	0.95
R7699:Igfals	UTSW	17	24880574	missense	probably damaging	1.00
R7700:Igfals	UTSW	17	24880574	missense	probably damaging	1.00
R8197:Igfals	UTSW	17	24880304	missense	probably benign	0.01
R8707:Igfals	UTSW	17	24880211	missense	possibly damaging	0.88
R8900:Igfals	UTSW	17	24880040	missense	possibly damaging	0.86
R9071:Igfals	UTSW	17	24880696	missense	probably damaging	0.99
R9389:Igfals	UTSW	17	24881626	missense	probably benign	0.04
R9655:Igfals	UTSW	17	24880691	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCCACAATCGTATCAGGCAGTTAG -3'
(R):5'- TTGTGTGAGAGGTCCAGCCAGAAG -3'

Sequencing Primer
(F):5'- ATCGTATCAGGCAGTTAGGTGAG -3'
(R):5'- ATCCTCAGAGAGCATTGTCAG -3'

Posted On

2014-05-09