Incidental Mutation 'R1653:Klc4'
ID188887
Institutional Source Beutler Lab
Gene Symbol Klc4
Ensembl Gene ENSMUSG00000003546
Gene Namekinesin light chain 4
SynonymsKnsl8, 1200014P03Rik
MMRRC Submission 039689-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.591) question?
Stock #R1653 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location46630631-46645144 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 46631859 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 593 (Y593C)
Ref Sequence ENSEMBL: ENSMUSP00000003642 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003642] [ENSMUST00000044442]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003642
AA Change: Y593C

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003642
Gene: ENSMUSG00000003546
AA Change: Y593C

DomainStartEndE-ValueType
coiled coil region 90 155 N/A INTRINSIC
low complexity region 194 204 N/A INTRINSIC
Pfam:TPR_10 210 251 9.4e-9 PFAM
TPR 253 286 3.32e-1 SMART
TPR 295 328 7.16e-6 SMART
TPR 337 370 4.21e-3 SMART
TPR 379 412 9.03e-3 SMART
low complexity region 429 443 N/A INTRINSIC
TPR 464 497 9.99e1 SMART
low complexity region 609 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000044442
SMART Domains Protein: ENSMUSP00000043703
Gene: ENSMUSG00000023972

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
IGc2 36 100 1.48e-6 SMART
IGc2 133 199 8.12e-13 SMART
IGc2 229 300 5.01e-4 SMART
IGc2 326 390 1.96e-6 SMART
IG 410 491 6.02e-7 SMART
IGc2 507 569 1.19e-10 SMART
IGc2 596 663 2.6e-11 SMART
transmembrane domain 696 718 N/A INTRINSIC
TyrKc 788 1053 4.34e-115 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181301
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.4%
  • 20x: 92.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130019O22Rik G T 7: 127,384,480 H483Q possibly damaging Het
Adam34 A T 8: 43,650,645 C654* probably null Het
Adamts19 T A 18: 58,890,293 N253K probably benign Het
Adgrb3 A G 1: 25,101,503 L1162S probably benign Het
Ap2b1 T A 11: 83,346,831 Y574N probably damaging Het
Atrn A G 2: 130,935,624 I198V probably benign Het
Bcan T A 3: 87,994,196 I400F probably damaging Het
Capn10 A G 1: 92,946,898 Y617C probably damaging Het
Capn8 A G 1: 182,623,951 N578D probably benign Het
Casd1 T C 6: 4,624,134 L309P probably benign Het
Ccser1 T A 6: 61,311,465 I204K probably benign Het
Cd276 T C 9: 58,537,449 T80A probably benign Het
Cdh3 T C 8: 106,539,068 S248P probably damaging Het
Celsr2 T C 3: 108,413,520 T659A possibly damaging Het
Col6a4 C T 9: 106,072,409 V676I probably damaging Het
Crmp1 T A 5: 37,286,468 V575D probably damaging Het
Ep400 G A 5: 110,693,174 Q1795* probably null Het
Gcnt3 A G 9: 70,035,077 C70R probably damaging Het
Gm12258 T C 11: 58,858,287 I96T possibly damaging Het
Gpr183 A G 14: 121,954,263 F282S probably damaging Het
Igfals T C 17: 24,881,078 V381A probably benign Het
Irs3 C A 5: 137,644,521 L218F probably damaging Het
Kdm5b T C 1: 134,602,481 F410S probably damaging Het
Lce1h T A 3: 92,763,443 Q134L unknown Het
Lyst T C 13: 13,635,226 S494P probably damaging Het
March3 A G 18: 56,811,895 M42T probably benign Het
Myh7 A G 14: 54,990,789 I250T probably benign Het
N4bp1 G T 8: 86,844,948 H807Q probably benign Het
Ndn C T 7: 62,348,508 P34L probably benign Het
Nfs1 C T 2: 156,125,336 G44D probably damaging Het
Nrg1 C T 8: 31,818,653 R445H probably damaging Het
Olfr1507 A T 14: 52,490,772 F64Y probably damaging Het
Olfr299 T C 7: 86,466,212 V267A probably benign Het
Olfr683 T A 7: 105,143,870 D141V possibly damaging Het
Pak7 C T 2: 136,116,887 V94M probably damaging Het
Pdk1 G A 2: 71,888,995 probably null Het
Sin3b G T 8: 72,741,519 V290L probably benign Het
Sirt1 T C 10: 63,321,809 T609A probably benign Het
Skint5 A T 4: 113,490,678 S1289T unknown Het
Slc32a1 A T 2: 158,614,889 H488L probably benign Het
Slc35b3 A G 13: 38,955,798 S18P probably benign Het
Spaca7 T A 8: 12,586,501 I109K possibly damaging Het
Tmem204 A G 17: 25,080,527 L6P possibly damaging Het
Tubgcp6 G A 15: 89,107,442 R651C probably damaging Het
Vps13b T A 15: 35,607,272 L1117* probably null Het
Wdcp T C 12: 4,851,815 L557P probably damaging Het
Wwp2 T C 8: 107,483,410 F140S possibly damaging Het
Zfp429 C T 13: 67,389,924 R467H possibly damaging Het
Zfp839 T A 12: 110,855,250 M166K probably benign Het
Zfyve9 G A 4: 108,660,577 Q1106* probably null Het
Zrsr1 T A 11: 22,974,158 C311S probably damaging Het
Other mutations in Klc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Klc4 APN 17 46635435 missense probably damaging 1.00
IGL01929:Klc4 APN 17 46644247 critical splice donor site probably null
IGL02550:Klc4 APN 17 46636910 splice site probably null
IGL03395:Klc4 APN 17 46632863 missense probably damaging 1.00
R0033:Klc4 UTSW 17 46635433 missense probably damaging 1.00
R1681:Klc4 UTSW 17 46636770 missense probably damaging 0.99
R1944:Klc4 UTSW 17 46636627 missense probably damaging 1.00
R4981:Klc4 UTSW 17 46644361 missense probably benign 0.03
R5417:Klc4 UTSW 17 46632031 critical splice donor site probably null
R5577:Klc4 UTSW 17 46635429 missense probably damaging 1.00
R5742:Klc4 UTSW 17 46642271 missense probably damaging 1.00
R6224:Klc4 UTSW 17 46640062 missense possibly damaging 0.71
R6245:Klc4 UTSW 17 46636679 missense probably damaging 1.00
R6516:Klc4 UTSW 17 46642255 missense probably damaging 1.00
R6890:Klc4 UTSW 17 46631843 missense probably benign 0.01
R6925:Klc4 UTSW 17 46636229 missense possibly damaging 0.69
R7466:Klc4 UTSW 17 46639910 missense probably benign 0.22
R7585:Klc4 UTSW 17 46631884 missense probably benign 0.01
R8273:Klc4 UTSW 17 46642154 missense possibly damaging 0.92
R8510:Klc4 UTSW 17 46644304 missense possibly damaging 0.93
R8723:Klc4 UTSW 17 46640700 missense probably benign 0.38
X0025:Klc4 UTSW 17 46640675 missense probably benign 0.12
Z1177:Klc4 UTSW 17 46635409 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ATGCCATGCTGTCAGTCTGACTCC -3'
(R):5'- CAAGATCCGGGATGTGCTTCGTAG -3'

Sequencing Primer
(F):5'- CTGTCAGTCTGACTCCTGAAGAG -3'
(R):5'- CCTTCCAGGTACATGACAAGTG -3'
Posted On2014-05-09