Mutagenetix > Incidental Mutation

Incidental Mutation 'R1654:Mgam'

188921

Institutional Source

Beutler Lab

Gene Symbol

Mgam

Ensembl Gene

ENSMUSG00000068587

Gene Name

maltase-glucoamylase

Synonyms

6030407P20Rik

MMRRC Submission

039690-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.180) question?

Stock #

R1654 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

40628831-40769123 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 40757487 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 743 (S743P)

Ref Sequence

ENSEMBL: ENSMUSP00000144680 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071535] [ENSMUST00000201148] [ENSMUST00000202779] [ENSMUST00000202966]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000071535
AA Change: S1489P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071466
Gene: ENSMUSG00000068587
AA Change: S1489P

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000201148
AA Change: S1489P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000143946
Gene: ENSMUSG00000068587
AA Change: S1489P

Domain	Start	End	E-Value	Type
transmembrane domain	12	34	N/A	INTRINSIC
low complexity region	47	59	N/A	INTRINSIC
PD	63	111	1.81e-8	SMART
Pfam:NtCtMGAM_N	124	233	6.2e-36	PFAM
Pfam:Glyco_hydro_31	323	795	3.4e-145	PFAM
PD	924	977	4.52e-9	SMART
Pfam:NtCtMGAM_N	988	1101	1.5e-30	PFAM
Blast:ANK	1141	1171	1e-7	BLAST
Pfam:Glyco_hydro_31	1189	1691	2e-139	PFAM
low complexity region	1776	1791	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202775

Predicted Effect

probably damaging
Transcript: ENSMUST00000202779
AA Change: S862P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144627
Gene: ENSMUSG00000068587
AA Change: S862P

Domain	Start	End	E-Value	Type
Pfam:Glyco_hydro_31	2	170	1.4e-53	PFAM
PD	297	350	1.4e-14	SMART
Pfam:NtCtMGAM_N	361	474	1.5e-26	PFAM
Blast:ANK	514	544	7e-8	BLAST
Pfam:Glyco_hydro_31	562	1064	2.2e-137	PFAM
low complexity region	1149	1164	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000202966
AA Change: S743P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144680
Gene: ENSMUSG00000068587
AA Change: S743P

Domain	Start	End	E-Value	Type
internal_repeat_1	2	88	2.6e-19	PROSPERO
PD	178	231	1.4e-14	SMART
Pfam:NtCtMGAM_N	242	355	1.1e-26	PFAM
Blast:ANK	395	425	6e-8	BLAST
Pfam:Glyco_hydro_31	443	945	1.3e-137	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes maltase-glucoamylase, which is a brush border membrane enzyme that plays a role in the final steps of digestion of starch. The protein has two catalytic sites identical to those of sucrase-isomaltase, but the proteins are only 59% homologous. Both are members of glycosyl hydrolase family 31, which has a variety of substrate specificities. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display abnormalities in starch digestion and prandial glucose homeostasis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	C	T	11: 109,797,399	S90N	probably benign	Het
Apc2	C	T	10: 80,301,842	T39I	possibly damaging	Het
Arfgef3	C	T	10: 18,625,148	R1118K	probably null	Het
Arhgef12	T	C	9: 42,997,660	D658G	possibly damaging	Het
Asph	G	T	4: 9,453,315	R736S	probably benign	Het
Bcas1	C	T	2: 170,349,246	G542E	probably damaging	Het
Brd8	A	T	18: 34,611,226	V183E	probably damaging	Het
C1rl	G	A	6: 124,493,910	G59E	probably damaging	Het
Cacna1i	C	A	15: 80,389,210	A1699D	probably damaging	Het
Card6	G	T	15: 5,098,732	Q1061K	probably benign	Het
Cd163	G	T	6: 124,317,581	C566F	probably damaging	Het
Cd84	C	T	1: 171,884,606	T263I	possibly damaging	Het
Cep63	T	C	9: 102,586,913	I740V	possibly damaging	Het
Chaf1b	C	A	16: 93,894,903	A279D	probably damaging	Het
Chsy3	A	T	18: 59,176,416	Y247F	probably damaging	Het
Cpxm1	G	A	2: 130,393,546	L509F	possibly damaging	Het
Disc1	A	T	8: 125,148,465	Q558L	possibly damaging	Het
Dnah3	A	T	7: 119,926,449	L3894Q	probably damaging	Het
Dnmt1	G	T	9: 20,936,574	T105N	possibly damaging	Het
Dock6	A	T	9: 21,804,843	L1732Q	probably damaging	Het
Dsc2	T	C	18: 20,046,246	N255S	probably benign	Het
Dsel	A	T	1: 111,862,512	Y98N	probably damaging	Het
Enox1	T	A	14: 77,611,374	I375N	possibly damaging	Het
Epha4	T	A	1: 77,374,768		probably null	Het
Fam71a	T	C	1: 191,163,481	R322G	probably benign	Het
Fktn	A	G	4: 53,761,220	I446V	probably benign	Het
Gm7361	G	T	5: 26,261,099	R153L	probably damaging	Het
Grin2c	C	T	11: 115,260,853	V94I	probably benign	Het
Kalrn	T	G	16: 33,975,738	L1222F	probably damaging	Het
Krt80	T	C	15: 101,351,709	K255E	probably damaging	Het
Lcn6	T	A	2: 25,680,775		probably null	Het
Lonp2	T	G	8: 86,631,450	L100V	probably damaging	Het
Lyn	G	A	4: 3,789,912	A482T	probably damaging	Het
Mapk4	A	G	18: 73,930,939	F404S	probably damaging	Het
Mast2	T	C	4: 116,316,550		probably null	Het
Medag	T	C	5: 149,422,135	Y94H	probably damaging	Het
Megf8	T	C	7: 25,338,486	L809P	possibly damaging	Het
Mia2	C	A	12: 59,108,833	T445K	possibly damaging	Het
Nars	C	G	18: 64,512,049	A43P	probably damaging	Het
Nav3	T	C	10: 109,853,123	N431S	possibly damaging	Het
Ndufaf5	A	G	2: 140,177,300		probably null	Het
Nlrp1b	T	G	11: 71,181,298	E573A	probably damaging	Het
Nlrp3	T	C	11: 59,543,123	V4A	probably benign	Het
Olfr1389	G	A	11: 49,430,502	G9R	probably benign	Het
Olfr194	T	C	16: 59,119,689	N127S	possibly damaging	Het
Olfr661	A	T	7: 104,688,213	Y66F	probably benign	Het
Pcdhb12	A	T	18: 37,436,701	D300V	probably damaging	Het
Pik3c2a	A	T	7: 116,368,848	C804S	probably benign	Het
Pkp4	A	T	2: 59,337,619	Q725L	probably damaging	Het
Ptpre	T	A	7: 135,653,928	S119T	probably benign	Het
Ptprk	G	A	10: 28,383,647	R361H	probably damaging	Het
Ptprr	T	C	10: 116,188,363	V193A	probably benign	Het
Rfx2	C	T	17: 56,808,263	A19T	probably benign	Het
Rgs4	T	A	1: 169,745,311	M19L	probably benign	Het
Rnf157	T	C	11: 116,358,715	H225R	probably damaging	Het
Rnf44	A	T	13: 54,681,779	D341E	possibly damaging	Het
Sct	T	A	7: 141,278,854	Q55L	probably damaging	Het
Sh3rf1	A	T	8: 61,361,745	H446L	possibly damaging	Het
Shisa3	A	T	5: 67,611,059	I101F	probably damaging	Het
Slc6a13	A	G	6: 121,336,926	I543V	probably benign	Het
Soga3	A	T	10: 29,146,935		probably null	Het
Spef2	G	A	15: 9,634,652	A1024V	probably damaging	Het
St6galnac6	T	C	2: 32,619,509	S330P	probably damaging	Het
Stard9	G	T	2: 120,703,722	A3487S	probably benign	Het
Suclg2	T	C	6: 95,655,551	S46G	probably damaging	Het
Syne2	T	C	12: 76,101,094	V6469A	possibly damaging	Het
Tada2b	C	T	5: 36,483,795	G88D	probably damaging	Het
Tll1	A	T	8: 64,117,903		probably null	Het
Tph2	T	A	10: 115,184,807	H28L	probably benign	Het
Trmt6	C	A	2: 132,815,835	V34L	possibly damaging	Het
Ttc22	A	G	4: 106,634,211	T204A	probably damaging	Het
Umodl1	A	T	17: 30,987,968	M778L	probably benign	Het
Vcan	T	C	13: 89,661,946	H2282R	probably damaging	Het
Vmn2r77	T	A	7: 86,811,915	S816R	probably damaging	Het
Vps13c	T	A	9: 67,951,687	F2806L	probably damaging	Het
Zbtb4	C	A	11: 69,779,169	A906D	probably damaging	Het
Zscan29	A	G	2: 121,164,779	V421A	probably benign	Het

Other mutations in Mgam

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01024:Mgam	APN	6	40643010	missense	probably benign
IGL01065:Mgam	APN	6	40662710	critical splice donor site	probably null
IGL01402:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01404:Mgam	APN	6	40644945	missense	probably benign	0.01
IGL01413:Mgam	APN	6	40661277	missense	probably damaging	1.00
IGL01546:Mgam	APN	6	40654693	missense	probably damaging	0.98
IGL01596:Mgam	APN	6	40658270	missense	probably damaging	1.00
IGL02133:Mgam	APN	6	40643076	missense	probably damaging	0.98
IGL02734:Mgam	APN	6	40662694	missense	probably damaging	1.00
BB002:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
BB012:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R0012:Mgam	UTSW	6	40765256	splice site	probably null
R0116:Mgam	UTSW	6	40658987	missense	probably damaging	1.00
R0310:Mgam	UTSW	6	40761035	splice site	probably benign
R0452:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
R0497:Mgam	UTSW	6	40664892	missense	probably damaging	1.00
R0699:Mgam	UTSW	6	40643019	missense	possibly damaging	0.84
R0738:Mgam	UTSW	6	40754935	missense	probably benign	0.01
R1033:Mgam	UTSW	6	40680624	missense	probably benign	0.07
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1403:Mgam	UTSW	6	40666881	missense	possibly damaging	0.93
R1430:Mgam	UTSW	6	40756371	missense	probably benign	0.08
R1432:Mgam	UTSW	6	40756367	missense	probably damaging	1.00
R1443:Mgam	UTSW	6	40759780	nonsense	probably null
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1470:Mgam	UTSW	6	40759128	missense	probably damaging	1.00
R1519:Mgam	UTSW	6	40661683	missense	probably benign	0.45
R1667:Mgam	UTSW	6	40677044	missense	possibly damaging	0.62
R1730:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1781:Mgam	UTSW	6	40669863	missense	probably damaging	1.00
R1783:Mgam	UTSW	6	40664860	missense	possibly damaging	0.92
R1829:Mgam	UTSW	6	40666892	missense	probably damaging	1.00
R1833:Mgam	UTSW	6	40654718	critical splice donor site	probably null
R1872:Mgam	UTSW	6	40661300	nonsense	probably null
R1912:Mgam	UTSW	6	40764185	nonsense	probably null
R1977:Mgam	UTSW	6	40664880	missense	probably benign	0.01
R2048:Mgam	UTSW	6	40656429	missense	possibly damaging	0.80
R2086:Mgam	UTSW	6	40761028	splice site	probably null
R2138:Mgam	UTSW	6	40756450	missense	probably damaging	1.00
R2224:Mgam	UTSW	6	40764274	splice site	probably null
R2408:Mgam	UTSW	6	40686522	missense	probably damaging	1.00
R2508:Mgam	UTSW	6	40759783	missense	probably damaging	1.00
R2842:Mgam	UTSW	6	40661345	missense	probably benign	0.01
R2847:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2848:Mgam	UTSW	6	40652715	missense	possibly damaging	0.67
R2965:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R2966:Mgam	UTSW	6	40768220	missense	possibly damaging	0.46
R3035:Mgam	UTSW	6	40663530	missense	probably benign
R3895:Mgam	UTSW	6	40759120	missense	probably damaging	1.00
R4027:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4030:Mgam	UTSW	6	40754902	missense	probably damaging	1.00
R4302:Mgam	UTSW	6	40763085	missense	probably benign	0.02
R4707:Mgam	UTSW	6	40714632	splice site	probably null
R4826:Mgam	UTSW	6	40680648	missense	possibly damaging	0.52
R4898:Mgam	UTSW	6	40643054	missense	probably benign
R5438:Mgam	UTSW	6	40684521	missense	probably damaging	1.00
R5492:Mgam	UTSW	6	40756363	missense	probably damaging	1.00
R5770:Mgam	UTSW	6	40669804	missense	probably benign	0.01
R5839:Mgam	UTSW	6	40740064	missense	possibly damaging	0.90
R5845:Mgam	UTSW	6	40675323	missense	possibly damaging	0.78
R5847:Mgam	UTSW	6	40684055	missense	probably benign	0.42
R5891:Mgam	UTSW	6	40744348	missense	probably benign
R6158:Mgam	UTSW	6	40757714	missense	probably damaging	1.00
R6193:Mgam	UTSW	6	40747920	nonsense	probably null
R6423:Mgam	UTSW	6	40677045	missense	possibly damaging	0.84
R6706:Mgam	UTSW	6	40744786	missense	probably benign	0.00
R6813:Mgam	UTSW	6	40750165	missense	probably damaging	0.99
R6863:Mgam	UTSW	6	40729009	missense	probably benign	0.00
R6906:Mgam	UTSW	6	40747919	missense	probably damaging	1.00
R7091:Mgam	UTSW	6	40768276	missense	possibly damaging	0.95
R7099:Mgam	UTSW	6	40661716	missense	probably benign	0.09
R7282:Mgam	UTSW	6	40656512	missense	possibly damaging	0.71
R7282:Mgam	UTSW	6	40763111	missense	probably benign
R7354:Mgam	UTSW	6	40744798	missense	probably damaging	1.00
R7374:Mgam	UTSW	6	40757439	missense	possibly damaging	0.89
R7399:Mgam	UTSW	6	40666854	missense	probably damaging	0.99
R7406:Mgam	UTSW	6	40663525	missense	probably benign	0.13
R7446:Mgam	UTSW	6	40746332	missense	probably damaging	1.00
R7466:Mgam	UTSW	6	40744789	missense	probably benign	0.00
R7525:Mgam	UTSW	6	40766020	missense	probably benign	0.01
R7530:Mgam	UTSW	6	40709218	splice site	probably null
R7570:Mgam	UTSW	6	40746433	missense	probably benign	0.16
R7669:Mgam	UTSW	6	40659010	missense	probably benign	0.00
R7679:Mgam	UTSW	6	40643046	missense	probably damaging	0.98
R7746:Mgam	UTSW	6	40668193	missense	probably damaging	0.99
R7859:Mgam	UTSW	6	40740179	missense	possibly damaging	0.75
R7925:Mgam	UTSW	6	40759051	missense	probably damaging	0.99
R8206:Mgam	UTSW	6	40680235	missense	probably benign	0.00
R8244:Mgam	UTSW	6	40750586	missense	probably damaging	1.00
R8309:Mgam	UTSW	6	40745177	missense	possibly damaging	0.88
R8472:Mgam	UTSW	6	40694526	splice site	probably null
R8758:Mgam	UTSW	6	40729043	missense	probably benign	0.41
R8777:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8777-TAIL:Mgam	UTSW	6	40655251	missense	probably damaging	0.97
R8783:Mgam	UTSW	6	40656489	missense	probably damaging	0.99
R8939:Mgam	UTSW	6	40763203	critical splice donor site	probably null
R8968:Mgam	UTSW	6	40757811	critical splice acceptor site	probably null
R8987:Mgam	UTSW	6	40729636	missense	probably damaging	1.00
R9055:Mgam	UTSW	6	40714729	intron	probably benign
R9171:Mgam	UTSW	6	40768212	missense	possibly damaging	0.76
R9252:Mgam	UTSW	6	40729643	missense	probably damaging	0.99
R9258:Mgam	UTSW	6	40680187	missense	probably benign
R9262:Mgam	UTSW	6	40746488	critical splice donor site	probably null
R9287:Mgam	UTSW	6	40728971	intron	probably benign
R9521:Mgam	UTSW	6	40745184	missense	probably damaging	1.00
R9589:Mgam	UTSW	6	40750585	missense	probably damaging	1.00
R9658:Mgam	UTSW	6	40744377	missense	possibly damaging	0.93
R9784:Mgam	UTSW	6	40759090	missense	probably damaging	1.00
RF011:Mgam	UTSW	6	40757436	missense	probably damaging	1.00
RF020:Mgam	UTSW	6	40685309	missense	probably damaging	1.00
RF023:Mgam	UTSW	6	40680708	missense	probably benign
X0021:Mgam	UTSW	6	40659047	missense	probably damaging	1.00
Z1088:Mgam	UTSW	6	40643060	missense	probably benign	0.01
Z1176:Mgam	UTSW	6	40677644	critical splice donor site	probably null
Z1176:Mgam	UTSW	6	40729066	missense	probably damaging	1.00
Z1177:Mgam	UTSW	6	40740071	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ATAGTCTCATCAGCCAGCAGGACC -3'
(R):5'- TGGAACAAAGTCAGCTCTTGGTGC -3'

Sequencing Primer
(F):5'- AGCCAGCAGGACCCTAAG -3'
(R):5'- GGCTGAAATCCATCATGCCTG -3'

Posted On

2014-05-09