Incidental Mutation 'R1654:Vmn2r77'
ID188930
Institutional Source Beutler Lab
Gene Symbol Vmn2r77
Ensembl Gene ENSMUSG00000090949
Gene Namevomeronasal 2, receptor 77
SynonymsEG546983
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location86795141-86812032 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86811915 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 816 (S816R)
Ref Sequence ENSEMBL: ENSMUSP00000129540 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164996]
Predicted Effect probably damaging
Transcript: ENSMUST00000164996
AA Change: S816R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129540
Gene: ENSMUSG00000090949
AA Change: S816R

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:ANF_receptor 78 467 1.4e-30 PFAM
Pfam:NCD3G 510 562 1e-20 PFAM
Pfam:7tm_3 594 830 2.6e-52 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Vmn2r77
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00954:Vmn2r77 APN 7 86800767 missense probably benign 0.06
IGL01105:Vmn2r77 APN 7 86811664 missense probably damaging 0.99
IGL01367:Vmn2r77 APN 7 86811916 missense probably damaging 0.98
IGL01634:Vmn2r77 APN 7 86811649 missense probably benign
IGL01805:Vmn2r77 APN 7 86811187 missense probably benign 0.18
IGL01868:Vmn2r77 APN 7 86803016 missense probably benign 0.00
IGL01980:Vmn2r77 APN 7 86801470 missense probably benign 0.14
IGL02055:Vmn2r77 APN 7 86801555 missense probably benign 0.00
IGL02066:Vmn2r77 APN 7 86803628 nonsense probably null
IGL02185:Vmn2r77 APN 7 86795152 missense unknown
IGL02200:Vmn2r77 APN 7 86801979 missense probably benign 0.04
IGL02336:Vmn2r77 APN 7 86802016 missense probably damaging 0.99
IGL02445:Vmn2r77 APN 7 86803640 nonsense probably null
IGL02557:Vmn2r77 APN 7 86795134 unclassified probably benign
IGL02659:Vmn2r77 APN 7 86800771 missense probably benign 0.32
IGL02978:Vmn2r77 APN 7 86811347 missense probably benign
IGL03180:Vmn2r77 APN 7 86801635 missense possibly damaging 0.85
IGL03255:Vmn2r77 APN 7 86811923 missense probably benign 0.04
IGL03273:Vmn2r77 APN 7 86811286 missense probably damaging 0.99
R0046:Vmn2r77 UTSW 7 86801938 missense possibly damaging 0.73
R0047:Vmn2r77 UTSW 7 86811650 missense probably benign 0.01
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0066:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R0389:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R0635:Vmn2r77 UTSW 7 86811175 missense probably benign
R0689:Vmn2r77 UTSW 7 86811664 missense probably damaging 0.99
R0827:Vmn2r77 UTSW 7 86802016 missense probably damaging 1.00
R1167:Vmn2r77 UTSW 7 86801746 missense probably benign 0.02
R1228:Vmn2r77 UTSW 7 86801034 critical splice donor site probably null
R1353:Vmn2r77 UTSW 7 86802186 missense probably benign 0.29
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1392:Vmn2r77 UTSW 7 86801622 missense probably benign 0.00
R1613:Vmn2r77 UTSW 7 86811148 missense probably damaging 1.00
R1742:Vmn2r77 UTSW 7 86795335 missense probably benign 0.35
R1827:Vmn2r77 UTSW 7 86801613 missense probably damaging 0.99
R1911:Vmn2r77 UTSW 7 86811793 missense probably damaging 1.00
R1974:Vmn2r77 UTSW 7 86800756 missense probably benign 0.17
R2008:Vmn2r77 UTSW 7 86801713 missense probably benign 0.31
R2093:Vmn2r77 UTSW 7 86801494 missense probably benign 0.29
R2143:Vmn2r77 UTSW 7 86811944 missense probably damaging 1.00
R2269:Vmn2r77 UTSW 7 86811689 missense probably benign 0.03
R2972:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R2974:Vmn2r77 UTSW 7 86803685 missense probably benign 0.01
R3037:Vmn2r77 UTSW 7 86800983 missense probably benign
R3694:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3695:Vmn2r77 UTSW 7 86800836 missense probably damaging 1.00
R3805:Vmn2r77 UTSW 7 86795160 nonsense probably null
R3870:Vmn2r77 UTSW 7 86811842 missense probably damaging 1.00
R4732:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R4733:Vmn2r77 UTSW 7 86800987 missense probably benign 0.00
R5009:Vmn2r77 UTSW 7 86801807 missense possibly damaging 0.82
R5201:Vmn2r77 UTSW 7 86811638 missense probably damaging 0.98
R5218:Vmn2r77 UTSW 7 86802133 missense probably damaging 0.98
R5469:Vmn2r77 UTSW 7 86802063 missense probably benign 0.01
R5673:Vmn2r77 UTSW 7 86812006 missense probably benign 0.05
R5771:Vmn2r77 UTSW 7 86812027 missense probably benign 0.06
R5832:Vmn2r77 UTSW 7 86811462 nonsense probably null
R5899:Vmn2r77 UTSW 7 86811716 missense probably damaging 1.00
R6151:Vmn2r77 UTSW 7 86801670 missense probably benign 0.00
R6182:Vmn2r77 UTSW 7 86811749 missense probably damaging 1.00
R6326:Vmn2r77 UTSW 7 86801823 missense probably benign
R6419:Vmn2r77 UTSW 7 86811559 missense probably damaging 0.99
R6549:Vmn2r77 UTSW 7 86800857 missense probably benign 0.06
R6874:Vmn2r77 UTSW 7 86802078 missense probably benign 0.00
R6972:Vmn2r77 UTSW 7 86802994 missense probably damaging 1.00
R7056:Vmn2r77 UTSW 7 86801815 missense probably benign 0.06
R7185:Vmn2r77 UTSW 7 86801827 missense probably benign 0.00
R7261:Vmn2r77 UTSW 7 86811310 nonsense probably null
R7298:Vmn2r77 UTSW 7 86800771 missense probably benign 0.00
R7662:Vmn2r77 UTSW 7 86811284 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCTGCAACAGACCACATTTGCCAT -3'
(R):5'- GTTCTAAagagagagagagagacagagagaca -3'

Sequencing Primer
(F):5'- GCTGATCTACACATGGTACATGG -3'
(R):5'- gagacagagagacagagatgatag -3'
Posted On2014-05-09