Incidental Mutation 'R1654:Ptpre'
ID188934
Institutional Source Beutler Lab
Gene Symbol Ptpre
Ensembl Gene ENSMUSG00000041836
Gene Nameprotein tyrosine phosphatase, receptor type, E
SynonymsPTPe, RPTPepsilon, PTPepsilon
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.661) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location135537481-135686293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 135653928 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 119 (S119T)
Ref Sequence ENSEMBL: ENSMUSP00000147524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073961] [ENSMUST00000209256] [ENSMUST00000209979] [ENSMUST00000210833] [ENSMUST00000211140] [ENSMUST00000211788]
Predicted Effect probably benign
Transcript: ENSMUST00000073961
AA Change: S106T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000073616
Gene: ENSMUSG00000041836
AA Change: S106T

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 25 36 N/A INTRINSIC
transmembrane domain 48 70 N/A INTRINSIC
PTPc 133 395 4.65e-136 SMART
PTPc 424 690 7.36e-116 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180693
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181940
Predicted Effect probably benign
Transcript: ENSMUST00000209256
AA Change: S126T

PolyPhen 2 Score 0.165 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000209979
AA Change: S49T

PolyPhen 2 Score 0.092 (Sensitivity: 0.93; Specificity: 0.85)
Predicted Effect probably benign
Transcript: ENSMUST00000210833
AA Change: S106T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210953
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211092
Predicted Effect probably benign
Transcript: ENSMUST00000211140
AA Change: S106T

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000211788
AA Change: S119T

PolyPhen 2 Score 0.318 (Sensitivity: 0.90; Specificity: 0.89)
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. Several alternatively spliced transcript variants of this gene have been reported, at least two of which encode a receptor-type PTP that possesses a short extracellular domain, a single transmembrane region, and two tandem intracytoplasmic catalytic domains; another one encodes a PTP that contains a distinct hydrophilic N-terminus, and thus represents a nonreceptor-type isoform of this PTP. Studies of the similar gene in mice suggested the regulatory roles of this PTP in RAS related signal transduction pathways, cytokine-induced SATA signaling, as well as the activation of voltage-gated K+ channels. [provided by RefSeq, Oct 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit early-onset peripheral myelination defects, increased activity of voltage-gated potassium channels in Schwann cells, and increased trabecular bone mass due to cell-specific defects in osteoclast function in young females. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Ptpre
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00918:Ptpre APN 7 135659053 missense probably damaging 0.98
IGL01019:Ptpre APN 7 135678325 nonsense probably null
IGL01115:Ptpre APN 7 135670764 missense probably damaging 1.00
IGL01456:Ptpre APN 7 135669802 missense probably damaging 1.00
IGL01516:Ptpre APN 7 135664999 missense probably damaging 0.97
IGL02108:Ptpre APN 7 135659102 missense possibly damaging 0.85
IGL02735:Ptpre APN 7 135667567 missense probably damaging 1.00
IGL03326:Ptpre APN 7 135672817 missense probably damaging 1.00
IGL03327:Ptpre APN 7 135672822 critical splice donor site probably null
R0183:Ptpre UTSW 7 135669845 missense probably benign 0.01
R0369:Ptpre UTSW 7 135670715 missense probably damaging 1.00
R0538:Ptpre UTSW 7 135663315 missense probably damaging 0.99
R0762:Ptpre UTSW 7 135679235 missense probably damaging 0.99
R1169:Ptpre UTSW 7 135667612 missense probably benign 0.33
R1214:Ptpre UTSW 7 135679258 missense probably damaging 1.00
R1629:Ptpre UTSW 7 135669799 missense probably damaging 1.00
R1819:Ptpre UTSW 7 135668993 splice site probably benign
R1876:Ptpre UTSW 7 135678317 missense possibly damaging 0.73
R2049:Ptpre UTSW 7 135670695 splice site probably benign
R2284:Ptpre UTSW 7 135669781 missense probably benign 0.05
R2895:Ptpre UTSW 7 135643858 nonsense probably null
R4508:Ptpre UTSW 7 135669103 missense probably damaging 1.00
R4603:Ptpre UTSW 7 135667643 nonsense probably null
R4644:Ptpre UTSW 7 135651932 intron probably benign
R4863:Ptpre UTSW 7 135669132 missense probably benign 0.00
R4989:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5015:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5133:Ptpre UTSW 7 135669132 missense probably benign 0.00
R5134:Ptpre UTSW 7 135652092 missense probably damaging 0.96
R5291:Ptpre UTSW 7 135678301 missense probably benign
R5372:Ptpre UTSW 7 135653940 missense possibly damaging 0.87
R5653:Ptpre UTSW 7 135653943 missense probably damaging 0.99
R5896:Ptpre UTSW 7 135674278 missense probably benign 0.39
R6238:Ptpre UTSW 7 135671180 missense probably damaging 1.00
R6974:Ptpre UTSW 7 135669148 missense possibly damaging 0.95
R7125:Ptpre UTSW 7 135654015 nonsense probably null
R7298:Ptpre UTSW 7 135683287 missense probably damaging 1.00
R7453:Ptpre UTSW 7 135538074 missense unknown
R7459:Ptpre UTSW 7 135667600 missense probably benign
R7855:Ptpre UTSW 7 135651995 missense probably benign
R7938:Ptpre UTSW 7 135651995 missense probably benign
R8003:Ptpre UTSW 7 135669036 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGACAGGAATGCTGCCATCAC -3'
(R):5'- AAAGTCCCGAGTCCCTGGAACTAC -3'

Sequencing Primer
(F):5'- CTGCCATCACTTGCTGAAAATAGG -3'
(R):5'- TTGAACTCCTCTCGGAATCG -3'
Posted On2014-05-09