Incidental Mutation 'R1654:Soga3'
ID188949
Institutional Source Beutler Lab
Gene Symbol Soga3
Ensembl Gene ENSMUSG00000038916
Gene NameSOGA family member 3
Synonyms6330407J23Rik
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.135) question?
Stock #R1654 (G1)
Quality Score211
Status Not validated
Chromosome10
Chromosomal Location29143839-29199630 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 29146935 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000092629] [ENSMUST00000216757]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000070359
SMART Domains Protein: ENSMUSP00000063425
Gene: ENSMUSG00000056316

DomainStartEndE-ValueType
low complexity region 65 83 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000092629
AA Change: T93S

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000090293
Gene: ENSMUSG00000038916
AA Change: T93S

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
low complexity region 72 81 N/A INTRINSIC
low complexity region 86 101 N/A INTRINSIC
low complexity region 110 126 N/A INTRINSIC
low complexity region 158 185 N/A INTRINSIC
low complexity region 214 247 N/A INTRINSIC
SCOP:d1fxkc_ 354 488 2e-4 SMART
Blast:BRLZ 356 384 6e-10 BLAST
Pfam:DUF3166 519 613 1.8e-34 PFAM
Pfam:DUF3166 639 727 4.6e-34 PFAM
transmembrane domain 917 939 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000213243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000213451
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214863
Predicted Effect probably benign
Transcript: ENSMUST00000216757
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zbtb4 C A 11: 69,779,169 A906D probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Soga3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Soga3 APN 10 29196473 nonsense probably null
IGL00929:Soga3 APN 10 29148292 missense probably damaging 0.99
IGL01450:Soga3 APN 10 29196323 missense probably damaging 1.00
IGL01462:Soga3 APN 10 29148258 missense probably damaging 1.00
IGL03062:Soga3 APN 10 29198949 missense probably damaging 1.00
R0534:Soga3 UTSW 10 29180956 splice site probably benign
R1355:Soga3 UTSW 10 29147322 missense probably benign 0.01
R1450:Soga3 UTSW 10 29147740 missense probably damaging 1.00
R1680:Soga3 UTSW 10 29196839 missense probably damaging 1.00
R2134:Soga3 UTSW 10 29196399 nonsense probably null
R2570:Soga3 UTSW 10 29146765 missense possibly damaging 0.88
R4395:Soga3 UTSW 10 29147355 missense probably benign
R4859:Soga3 UTSW 10 29150394 missense probably benign 0.00
R4883:Soga3 UTSW 10 29196541 missense probably damaging 1.00
R4884:Soga3 UTSW 10 29196541 missense probably damaging 1.00
R5288:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5335:Soga3 UTSW 10 29147106 missense probably benign
R5384:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5385:Soga3 UTSW 10 29196770 missense probably benign 0.00
R5457:Soga3 UTSW 10 29196724 missense probably benign 0.01
R5813:Soga3 UTSW 10 29150244 missense probably damaging 1.00
R5819:Soga3 UTSW 10 29197273 missense probably benign 0.00
R5950:Soga3 UTSW 10 29143648 unclassified probably benign
R6567:Soga3 UTSW 10 29147283 missense probably benign 0.00
R7312:Soga3 UTSW 10 29197244 missense probably damaging 1.00
R7313:Soga3 UTSW 10 29196879 nonsense probably null
R7445:Soga3 UTSW 10 29197003 missense possibly damaging 0.91
R7481:Soga3 UTSW 10 29196523 missense probably damaging 1.00
R7609:Soga3 UTSW 10 29148228 missense probably damaging 1.00
R7616:Soga3 UTSW 10 29146578 start gained probably benign
R7665:Soga3 UTSW 10 29196397 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTAGACTGCCATGAGTCAGCCAC -3'
(R):5'- TGCCGCTACCAGAGTTTCTGCTAC -3'

Sequencing Primer
(F):5'- ATGAGTCAGCCACCGTCC -3'
(R):5'- ccccctcctactccccc -3'
Posted On2014-05-09