Mutagenetix > Incidental Mutations

Incidental Mutation 'R1654:Nav3'

188951

Institutional Source

Beutler Lab

Gene Symbol

Nav3

Ensembl Gene

ENSMUSG00000020181

Gene Name

neuron navigator 3

Synonyms

POMFIL1, 9630020C08Rik, 4732483H20Rik, unc53H3, steerin 3, Pomfil1p

MMRRC Submission

039690-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1654 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

109681259-110456204 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 109853123 bp

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Serine at position 431 (N431S)

Ref Sequence

ENSEMBL: ENSMUSP00000032719 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032719]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000032719
AA Change: N431S

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000032719
Gene: ENSMUSG00000020181
AA Change: N431S

Domain	Start	End	E-Value	Type
CH	79	182	4.41e-12	SMART
low complexity region	184	194	N/A	INTRINSIC
low complexity region	318	329	N/A	INTRINSIC
low complexity region	353	363	N/A	INTRINSIC
low complexity region	427	439	N/A	INTRINSIC
low complexity region	522	536	N/A	INTRINSIC
low complexity region	713	724	N/A	INTRINSIC
low complexity region	807	818	N/A	INTRINSIC
low complexity region	873	896	N/A	INTRINSIC
low complexity region	904	916	N/A	INTRINSIC
low complexity region	1077	1095	N/A	INTRINSIC
low complexity region	1160	1173	N/A	INTRINSIC
low complexity region	1207	1229	N/A	INTRINSIC
low complexity region	1256	1266	N/A	INTRINSIC
low complexity region	1274	1285	N/A	INTRINSIC
low complexity region	1293	1312	N/A	INTRINSIC
low complexity region	1327	1341	N/A	INTRINSIC
low complexity region	1383	1397	N/A	INTRINSIC
low complexity region	1462	1474	N/A	INTRINSIC
low complexity region	1550	1563	N/A	INTRINSIC
coiled coil region	1565	1656	N/A	INTRINSIC
low complexity region	1675	1692	N/A	INTRINSIC
low complexity region	1722	1733	N/A	INTRINSIC
low complexity region	1756	1781	N/A	INTRINSIC
low complexity region	1782	1795	N/A	INTRINSIC
coiled coil region	1801	1842	N/A	INTRINSIC
low complexity region	1848	1871	N/A	INTRINSIC
AAA	2029	2184	4.94e-7	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.4%
10x: 96.5%
20x: 93.0%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the neuron navigator family and is expressed predominantly in the nervous system. The encoded protein contains coiled-coil domains and a conserved AAA domain characteristic for ATPases associated with a variety of cellular activities. This gene is similar to unc-53, a Caenorhabditis elegans gene involved in axon guidance. Multiple alternatively spliced transcript variants for this gene have been described but only one has had its full-length nature determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700012B07Rik	C	T	11: 109,797,399	S90N	probably benign	Het
Apc2	C	T	10: 80,301,842	T39I	possibly damaging	Het
Arfgef3	C	T	10: 18,625,148	R1118K	probably null	Het
Arhgef12	T	C	9: 42,997,660	D658G	possibly damaging	Het
Asph	G	T	4: 9,453,315	R736S	probably benign	Het
Bcas1	C	T	2: 170,349,246	G542E	probably damaging	Het
Brd8	A	T	18: 34,611,226	V183E	probably damaging	Het
C1rl	G	A	6: 124,493,910	G59E	probably damaging	Het
Cacna1i	C	A	15: 80,389,210	A1699D	probably damaging	Het
Card6	G	T	15: 5,098,732	Q1061K	probably benign	Het
Cd163	G	T	6: 124,317,581	C566F	probably damaging	Het
Cd84	C	T	1: 171,884,606	T263I	possibly damaging	Het
Cep63	T	C	9: 102,586,913	I740V	possibly damaging	Het
Chaf1b	C	A	16: 93,894,903	A279D	probably damaging	Het
Chsy3	A	T	18: 59,176,416	Y247F	probably damaging	Het
Cpxm1	G	A	2: 130,393,546	L509F	possibly damaging	Het
Disc1	A	T	8: 125,148,465	Q558L	possibly damaging	Het
Dnah3	A	T	7: 119,926,449	L3894Q	probably damaging	Het
Dnmt1	G	T	9: 20,936,574	T105N	possibly damaging	Het
Dock6	A	T	9: 21,804,843	L1732Q	probably damaging	Het
Dsc2	T	C	18: 20,046,246	N255S	probably benign	Het
Dsel	A	T	1: 111,862,512	Y98N	probably damaging	Het
Enox1	T	A	14: 77,611,374	I375N	possibly damaging	Het
Epha4	T	A	1: 77,374,768		probably null	Het
Fam71a	T	C	1: 191,163,481	R322G	probably benign	Het
Fktn	A	G	4: 53,761,220	I446V	probably benign	Het
Gm7361	G	T	5: 26,261,099	R153L	probably damaging	Het
Grin2c	C	T	11: 115,260,853	V94I	probably benign	Het
Kalrn	T	G	16: 33,975,738	L1222F	probably damaging	Het
Krt80	T	C	15: 101,351,709	K255E	probably damaging	Het
Lcn6	T	A	2: 25,680,775		probably null	Het
Lonp2	T	G	8: 86,631,450	L100V	probably damaging	Het
Lyn	G	A	4: 3,789,912	A482T	probably damaging	Het
Mapk4	A	G	18: 73,930,939	F404S	probably damaging	Het
Mast2	T	C	4: 116,316,550		probably null	Het
Medag	T	C	5: 149,422,135	Y94H	probably damaging	Het
Megf8	T	C	7: 25,338,486	L809P	possibly damaging	Het
Mgam	T	C	6: 40,757,487	S743P	probably damaging	Het
Mia2	C	A	12: 59,108,833	T445K	possibly damaging	Het
Nars	C	G	18: 64,512,049	A43P	probably damaging	Het
Ndufaf5	A	G	2: 140,177,300		probably null	Het
Nlrp1b	T	G	11: 71,181,298	E573A	probably damaging	Het
Nlrp3	T	C	11: 59,543,123	V4A	probably benign	Het
Olfr1389	G	A	11: 49,430,502	G9R	probably benign	Het
Olfr194	T	C	16: 59,119,689	N127S	possibly damaging	Het
Olfr661	A	T	7: 104,688,213	Y66F	probably benign	Het
Pcdhb12	A	T	18: 37,436,701	D300V	probably damaging	Het
Pik3c2a	A	T	7: 116,368,848	C804S	probably benign	Het
Pkp4	A	T	2: 59,337,619	Q725L	probably damaging	Het
Ptpre	T	A	7: 135,653,928	S119T	probably benign	Het
Ptprk	G	A	10: 28,383,647	R361H	probably damaging	Het
Ptprr	T	C	10: 116,188,363	V193A	probably benign	Het
Rfx2	C	T	17: 56,808,263	A19T	probably benign	Het
Rgs4	T	A	1: 169,745,311	M19L	probably benign	Het
Rnf157	T	C	11: 116,358,715	H225R	probably damaging	Het
Rnf44	A	T	13: 54,681,779	D341E	possibly damaging	Het
Sct	T	A	7: 141,278,854	Q55L	probably damaging	Het
Sh3rf1	A	T	8: 61,361,745	H446L	possibly damaging	Het
Shisa3	A	T	5: 67,611,059	I101F	probably damaging	Het
Slc6a13	A	G	6: 121,336,926	I543V	probably benign	Het
Soga3	A	T	10: 29,146,935		probably null	Het
Spef2	G	A	15: 9,634,652	A1024V	probably damaging	Het
St6galnac6	T	C	2: 32,619,509	S330P	probably damaging	Het
Stard9	G	T	2: 120,703,722	A3487S	probably benign	Het
Suclg2	T	C	6: 95,655,551	S46G	probably damaging	Het
Syne2	T	C	12: 76,101,094	V6469A	possibly damaging	Het
Tada2b	C	T	5: 36,483,795	G88D	probably damaging	Het
Tll1	A	T	8: 64,117,903		probably null	Het
Tph2	T	A	10: 115,184,807	H28L	probably benign	Het
Trmt6	C	A	2: 132,815,835	V34L	possibly damaging	Het
Ttc22	A	G	4: 106,634,211	T204A	probably damaging	Het
Umodl1	A	T	17: 30,987,968	M778L	probably benign	Het
Vcan	T	C	13: 89,661,946	H2282R	probably damaging	Het
Vmn2r77	T	A	7: 86,811,915	S816R	probably damaging	Het
Vps13c	T	A	9: 67,951,687	F2806L	probably damaging	Het
Zbtb4	C	A	11: 69,779,169	A906D	probably damaging	Het
Zscan29	A	G	2: 121,164,779	V421A	probably benign	Het

Other mutations in Nav3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00095:Nav3	APN	10	109841733	missense	probably damaging	0.99
IGL00425:Nav3	APN	10	109703507	missense	probably benign	0.13
IGL00465:Nav3	APN	10	109852746	missense	probably damaging	0.99
IGL00531:Nav3	APN	10	109703310	missense	probably null	0.99
IGL00575:Nav3	APN	10	109764765	missense	probably damaging	0.98
IGL00770:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00774:Nav3	APN	10	109816263	missense	probably damaging	1.00
IGL00858:Nav3	APN	10	109742632	missense	probably damaging	0.98
IGL00935:Nav3	APN	10	109705666	missense	probably benign
IGL01638:Nav3	APN	10	109852863	missense	probably damaging	1.00
IGL01662:Nav3	APN	10	109769258	missense	possibly damaging	0.56
IGL01670:Nav3	APN	10	109714241	missense	possibly damaging	0.92
IGL01885:Nav3	APN	10	109742660	nonsense	probably null
IGL01979:Nav3	APN	10	109704929	missense	probably benign	0.01
IGL02121:Nav3	APN	10	109759036	missense	probably damaging	0.99
IGL02210:Nav3	APN	10	109766990	missense	probably benign
IGL02523:Nav3	APN	10	109769296	missense	probably damaging	1.00
IGL02573:Nav3	APN	10	109866974	missense	probably benign	0.23
IGL02633:Nav3	APN	10	109692136	missense	probably benign	0.09
IGL02810:Nav3	APN	10	109816274	missense	probably damaging	1.00
IGL02964:Nav3	APN	10	109736953	missense	probably damaging	0.99
IGL03015:Nav3	APN	10	109718297	missense	probably damaging	0.98
IGL03288:Nav3	APN	10	109759017	missense	probably damaging	1.00
IGL03310:Nav3	APN	10	109824572	critical splice donor site	probably null
PIT4377001:Nav3	UTSW	10	109716605	missense	probably damaging	0.99
R0010:Nav3	UTSW	10	109823226	splice site	probably benign
R0043:Nav3	UTSW	10	109767518	missense	possibly damaging	0.95
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0053:Nav3	UTSW	10	109766917	splice site	probably benign
R0077:Nav3	UTSW	10	109716642	missense	possibly damaging	0.87
R0219:Nav3	UTSW	10	109866930	critical splice donor site	probably null
R0310:Nav3	UTSW	10	109767128	missense	possibly damaging	0.82
R0380:Nav3	UTSW	10	109758879	splice site	probably benign
R0403:Nav3	UTSW	10	109767103	missense	probably damaging	0.98
R0480:Nav3	UTSW	10	109853300	missense	probably damaging	1.00
R0626:Nav3	UTSW	10	109823464	missense	probably damaging	1.00
R0637:Nav3	UTSW	10	109770197	missense	probably benign	0.25
R0847:Nav3	UTSW	10	109903857	missense	possibly damaging	0.94
R0988:Nav3	UTSW	10	109716528	missense	probably damaging	1.00
R1272:Nav3	UTSW	10	109736999	missense	probably damaging	0.98
R1295:Nav3	UTSW	10	109692102	missense	probably damaging	1.00
R1405:Nav3	UTSW	10	109770333	splice site	probably benign
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1406:Nav3	UTSW	10	109883634	missense	possibly damaging	0.64
R1420:Nav3	UTSW	10	109823254	missense	probably benign	0.02
R1449:Nav3	UTSW	10	109853511	missense	probably benign	0.13
R1458:Nav3	UTSW	10	109720044	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1469:Nav3	UTSW	10	109760508	missense	probably damaging	1.00
R1472:Nav3	UTSW	10	109727941	missense	probably damaging	0.99
R1537:Nav3	UTSW	10	109866985	missense	probably damaging	1.00
R1539:Nav3	UTSW	10	109767170	missense	probably damaging	0.99
R1581:Nav3	UTSW	10	109823428	missense	probably damaging	1.00
R1586:Nav3	UTSW	10	109853254	missense	probably damaging	1.00
R1725:Nav3	UTSW	10	109823590	missense	probably damaging	1.00
R1742:Nav3	UTSW	10	109769213	missense	probably benign
R1793:Nav3	UTSW	10	109703372	missense	probably benign	0.00
R1830:Nav3	UTSW	10	109823323	missense	probably damaging	1.00
R1834:Nav3	UTSW	10	109720022	missense	probably damaging	0.99
R1881:Nav3	UTSW	10	109852559	missense	probably damaging	0.96
R1922:Nav3	UTSW	10	109705606	missense	probably benign	0.43
R1944:Nav3	UTSW	10	109716530	missense	probably damaging	0.99
R1981:Nav3	UTSW	10	109719090	splice site	probably benign
R1985:Nav3	UTSW	10	109770184	splice site	probably benign
R1996:Nav3	UTSW	10	109853401	missense	probably damaging	1.00
R2051:Nav3	UTSW	10	109824675	missense	probably damaging	0.99
R2062:Nav3	UTSW	10	109720021	missense	probably damaging	1.00
R2139:Nav3	UTSW	10	109853135	missense	probably benign	0.22
R2248:Nav3	UTSW	10	109696227	missense	probably damaging	1.00
R2420:Nav3	UTSW	10	109863813	missense	probably damaging	0.98
R2444:Nav3	UTSW	10	109764915	missense	probably benign	0.09
R3026:Nav3	UTSW	10	109824604	missense	probably damaging	0.99
R3052:Nav3	UTSW	10	109903752	missense	probably damaging	0.99
R3441:Nav3	UTSW	10	109704928	missense	probably benign	0.01
R3845:Nav3	UTSW	10	109853376	missense	possibly damaging	0.82
R3929:Nav3	UTSW	10	109684203	missense	probably damaging	1.00
R3932:Nav3	UTSW	10	109694035	missense	probably damaging	0.99
R4056:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4057:Nav3	UTSW	10	109880533	critical splice donor site	probably null
R4120:Nav3	UTSW	10	109903744	critical splice donor site	probably null
R4244:Nav3	UTSW	10	109769296	missense	probably damaging	1.00
R4361:Nav3	UTSW	10	109852986	missense	probably damaging	1.00
R4512:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4514:Nav3	UTSW	10	109694082	missense	possibly damaging	0.89
R4700:Nav3	UTSW	10	109764935	missense	probably benign	0.10
R4815:Nav3	UTSW	10	109823552	missense	probably benign
R4981:Nav3	UTSW	10	109880692	missense	probably benign
R5042:Nav3	UTSW	10	109769268	missense	probably benign	0.27
R5251:Nav3	UTSW	10	109853253	missense	probably damaging	0.99
R5252:Nav3	UTSW	10	109714291	small deletion	probably benign
R5273:Nav3	UTSW	10	109693038	critical splice donor site	probably null
R5288:Nav3	UTSW	10	109853105	missense	probably benign	0.10
R5407:Nav3	UTSW	10	109866935	missense	probably benign	0.28
R5533:Nav3	UTSW	10	109883678	missense	possibly damaging	0.61
R5561:Nav3	UTSW	10	109716552	missense	probably damaging	1.00
R5577:Nav3	UTSW	10	109769403	missense	probably damaging	1.00
R5656:Nav3	UTSW	10	109764633	missense	probably damaging	0.96
R5872:Nav3	UTSW	10	109764787	missense	probably damaging	1.00
R6023:Nav3	UTSW	10	109823515	missense	possibly damaging	0.95
R6061:Nav3	UTSW	10	109866984	nonsense	probably null
R6189:Nav3	UTSW	10	109720019	missense	probably damaging	0.98
R6214:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6215:Nav3	UTSW	10	109852565	missense	probably damaging	1.00
R6264:Nav3	UTSW	10	109688833	missense	probably damaging	0.97
R6500:Nav3	UTSW	10	109764756	missense	probably damaging	1.00
R6524:Nav3	UTSW	10	109720030	missense	probably damaging	0.99
R6868:Nav3	UTSW	10	109693166	missense	possibly damaging	0.49
R7079:Nav3	UTSW	10	109767292	missense	probably benign	0.16
R7099:Nav3	UTSW	10	109703334	missense	probably benign	0.11
R7139:Nav3	UTSW	10	109853477	missense	probably benign	0.44
R7238:Nav3	UTSW	10	109853324	missense	possibly damaging	0.75
R7338:Nav3	UTSW	10	109769212	missense	probably benign	0.04
R7343:Nav3	UTSW	10	109903758	missense	probably damaging	0.98
R7383:Nav3	UTSW	10	109716671	missense	probably damaging	0.98
R7391:Nav3	UTSW	10	109703456	missense	probably benign	0.07
R7399:Nav3	UTSW	10	109852934	missense	possibly damaging	0.74
R7457:Nav3	UTSW	10	109696328	nonsense	probably null
R7462:Nav3	UTSW	10	109823578	missense	probably damaging	1.00
R7542:Nav3	UTSW	10	109823533	missense	possibly damaging	0.89
R7659:Nav3	UTSW	10	109766990	missense	probably benign	0.09
R7749:Nav3	UTSW	10	109703352	missense	probably damaging	0.99
R7794:Nav3	UTSW	10	109688856	missense	probably benign	0.08
R7876:Nav3	UTSW	10	109853498	missense	probably benign	0.26
R8048:Nav3	UTSW	10	109764918	missense	probably benign	0.13
R8104:Nav3	UTSW	10	109758967	missense	probably damaging	0.99
R8125:Nav3	UTSW	10	109852659	missense	probably damaging	0.99
R8275:Nav3	UTSW	10	109692123	missense	noncoding transcript
R8325:Nav3	UTSW	10	109705603	missense	probably benign	0.24
R8336:Nav3	UTSW	10	109767569	missense	probably damaging	0.99
R8523:Nav3	UTSW	10	109823277	missense	probably damaging	1.00
R8529:Nav3	UTSW	10	109853331	missense	probably benign	0.09
X0012:Nav3	UTSW	10	109692097	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CGACTTCTCAGCGCAGGCTTTATTC -3'
(R):5'- ATGTCAAGCACAGTGCCACCTC -3'

Sequencing Primer
(F):5'- AGCGCAGGCTTTATTCTTGTC -3'
(R):5'- TCTACCATGCTGACAGTGAAG -3'

Posted On

2014-05-09