Incidental Mutation 'R1654:Nlrp3'
ID 188956
Institutional Source Beutler Lab
Gene Symbol Nlrp3
Ensembl Gene ENSMUSG00000032691
Gene Name NLR family, pyrin domain containing 3
Synonyms Mmig1, Cias1, NALP3, cryopyrin, Pypaf1
MMRRC Submission 039690-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.076) question?
Stock # R1654 (G1)
Quality Score 225
Status Not validated
Chromosome 11
Chromosomal Location 59432395-59457781 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 59433949 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 4 (V4A)
Ref Sequence ENSEMBL: ENSMUSP00000114231 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079476] [ENSMUST00000101148] [ENSMUST00000149126]
AlphaFold Q8R4B8
Predicted Effect probably benign
Transcript: ENSMUST00000079476
AA Change: V4A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000078440
Gene: ENSMUSG00000032691
AA Change: V4A

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000101148
AA Change: V4A

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000098707
Gene: ENSMUSG00000032691
AA Change: V4A

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
FISNA 135 206 1.45e-22 SMART
Pfam:NACHT 216 385 6.7e-52 PFAM
low complexity region 533 539 N/A INTRINSIC
low complexity region 688 697 N/A INTRINSIC
LRR_RI 737 764 1.07e-9 SMART
LRR 766 793 5.13e1 SMART
LRR 794 821 3.86e-7 SMART
LRR 823 850 1.62e0 SMART
LRR 851 878 3.39e-3 SMART
LRR 880 907 1.2e2 SMART
LRR 908 935 2.24e-3 SMART
LRR 937 964 2.16e2 SMART
LRR 965 992 8.73e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149126
AA Change: V4A

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000114231
Gene: ENSMUSG00000032691
AA Change: V4A

DomainStartEndE-ValueType
PYRIN 4 87 6.39e-33 SMART
Pfam:FISNA 135 173 1.6e-12 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a pyrin-like protein containing a pyrin domain, a nucleotide-binding site (NBS) domain, and a leucine-rich repeat (LRR) motif. This protein interacts with the apoptosis-associated speck-like protein PYCARD/ASC, which contains a caspase recruitment domain, and is a member of the NALP3 inflammasome complex. This complex functions as an upstream activator of NF-kappaB signaling, and it plays a role in the regulation of inflammation, the immune response, and apoptosis. Mutations in this gene are associated with familial cold autoinflammatory syndrome (FCAS), Muckle-Wells syndrome (MWS), chronic infantile neurological cutaneous and articular (CINCA) syndrome, and neonatal-onset multisystem inflammatory disease (NOMID). Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified for this gene. Alternative 5' UTR structures are suggested by available data; however, insufficient evidence is available to determine if all of the represented 5' UTR splice patterns are biologically valid. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for null mutations exhibit attenuated inflammatory responses related to decrease secretion of IL-1beta and IL-18. Mice heterozygous for activating mutations suffer from autoinflammatory attacks that lead to organ failure and death before weaning. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(9) Chemically induced(4)

Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,688,225 (GRCm39) S90N probably benign Het
Apc2 C T 10: 80,137,676 (GRCm39) T39I possibly damaging Het
Arfgef3 C T 10: 18,500,896 (GRCm39) R1118K probably null Het
Arhgef12 T C 9: 42,908,956 (GRCm39) D658G possibly damaging Het
Asph G T 4: 9,453,315 (GRCm39) R736S probably benign Het
Bcas1 C T 2: 170,191,166 (GRCm39) G542E probably damaging Het
Brd8 A T 18: 34,744,279 (GRCm39) V183E probably damaging Het
C1rl G A 6: 124,470,869 (GRCm39) G59E probably damaging Het
Cacna1i C A 15: 80,273,411 (GRCm39) A1699D probably damaging Het
Card6 G T 15: 5,128,214 (GRCm39) Q1061K probably benign Het
Cd163 G T 6: 124,294,540 (GRCm39) C566F probably damaging Het
Cd84 C T 1: 171,712,173 (GRCm39) T263I possibly damaging Het
Cep63 T C 9: 102,464,112 (GRCm39) I740V possibly damaging Het
Chaf1b C A 16: 93,691,791 (GRCm39) A279D probably damaging Het
Chsy3 A T 18: 59,309,488 (GRCm39) Y247F probably damaging Het
Cpxm1 G A 2: 130,235,466 (GRCm39) L509F possibly damaging Het
Disc1 A T 8: 125,875,204 (GRCm39) Q558L possibly damaging Het
Dnah3 A T 7: 119,525,672 (GRCm39) L3894Q probably damaging Het
Dnmt1 G T 9: 20,847,870 (GRCm39) T105N possibly damaging Het
Dock6 A T 9: 21,716,139 (GRCm39) L1732Q probably damaging Het
Dsc2 T C 18: 20,179,303 (GRCm39) N255S probably benign Het
Dsel A T 1: 111,790,242 (GRCm39) Y98N probably damaging Het
Enox1 T A 14: 77,848,814 (GRCm39) I375N possibly damaging Het
Epha4 T A 1: 77,351,405 (GRCm39) probably null Het
Fktn A G 4: 53,761,220 (GRCm39) I446V probably benign Het
Garin4 T C 1: 190,895,678 (GRCm39) R322G probably benign Het
Gm7361 G T 5: 26,466,097 (GRCm39) R153L probably damaging Het
Grin2c C T 11: 115,151,679 (GRCm39) V94I probably benign Het
Kalrn T G 16: 33,796,108 (GRCm39) L1222F probably damaging Het
Krt80 T C 15: 101,249,590 (GRCm39) K255E probably damaging Het
Lcn6 T A 2: 25,570,787 (GRCm39) probably null Het
Lonp2 T G 8: 87,358,078 (GRCm39) L100V probably damaging Het
Lyn G A 4: 3,789,912 (GRCm39) A482T probably damaging Het
Mapk4 A G 18: 74,064,010 (GRCm39) F404S probably damaging Het
Mast2 T C 4: 116,173,747 (GRCm39) probably null Het
Medag T C 5: 149,345,600 (GRCm39) Y94H probably damaging Het
Megf8 T C 7: 25,037,911 (GRCm39) L809P possibly damaging Het
Mgam T C 6: 40,734,421 (GRCm39) S743P probably damaging Het
Mia2 C A 12: 59,155,619 (GRCm39) T445K possibly damaging Het
Mtcl3 A T 10: 29,022,931 (GRCm39) probably null Het
Nars1 C G 18: 64,645,120 (GRCm39) A43P probably damaging Het
Nav3 T C 10: 109,688,984 (GRCm39) N431S possibly damaging Het
Ndufaf5 A G 2: 140,019,220 (GRCm39) probably null Het
Nlrp1b T G 11: 71,072,124 (GRCm39) E573A probably damaging Het
Or2y1d G A 11: 49,321,329 (GRCm39) G9R probably benign Het
Or56b2 A T 7: 104,337,420 (GRCm39) Y66F probably benign Het
Or5ac15 T C 16: 58,940,052 (GRCm39) N127S possibly damaging Het
Pcdhb12 A T 18: 37,569,754 (GRCm39) D300V probably damaging Het
Pik3c2a A T 7: 115,968,083 (GRCm39) C804S probably benign Het
Pkp4 A T 2: 59,167,963 (GRCm39) Q725L probably damaging Het
Ptpre T A 7: 135,255,657 (GRCm39) S119T probably benign Het
Ptprk G A 10: 28,259,643 (GRCm39) R361H probably damaging Het
Ptprr T C 10: 116,024,268 (GRCm39) V193A probably benign Het
Rfx2 C T 17: 57,115,263 (GRCm39) A19T probably benign Het
Rgs4 T A 1: 169,572,880 (GRCm39) M19L probably benign Het
Rnf157 T C 11: 116,249,541 (GRCm39) H225R probably damaging Het
Rnf44 A T 13: 54,829,592 (GRCm39) D341E possibly damaging Het
Sct T A 7: 140,858,767 (GRCm39) Q55L probably damaging Het
Sh3rf1 A T 8: 61,814,779 (GRCm39) H446L possibly damaging Het
Shisa3 A T 5: 67,768,402 (GRCm39) I101F probably damaging Het
Slc6a13 A G 6: 121,313,885 (GRCm39) I543V probably benign Het
Spef2 G A 15: 9,634,738 (GRCm39) A1024V probably damaging Het
St6galnac6 T C 2: 32,509,521 (GRCm39) S330P probably damaging Het
Stard9 G T 2: 120,534,203 (GRCm39) A3487S probably benign Het
Suclg2 T C 6: 95,632,532 (GRCm39) S46G probably damaging Het
Syne2 T C 12: 76,147,868 (GRCm39) V6469A possibly damaging Het
Tada2b C T 5: 36,641,139 (GRCm39) G88D probably damaging Het
Tll1 A T 8: 64,570,937 (GRCm39) probably null Het
Tph2 T A 10: 115,020,712 (GRCm39) H28L probably benign Het
Trmt6 C A 2: 132,657,755 (GRCm39) V34L possibly damaging Het
Ttc22 A G 4: 106,491,408 (GRCm39) T204A probably damaging Het
Umodl1 A T 17: 31,206,942 (GRCm39) M778L probably benign Het
Vcan T C 13: 89,810,065 (GRCm39) H2282R probably damaging Het
Vmn2r77 T A 7: 86,461,123 (GRCm39) S816R probably damaging Het
Vps13c T A 9: 67,858,969 (GRCm39) F2806L probably damaging Het
Zbtb4 C A 11: 69,669,995 (GRCm39) A906D probably damaging Het
Zscan29 A G 2: 120,995,260 (GRCm39) V421A probably benign Het
Other mutations in Nlrp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Nlrp3 APN 11 59,456,769 (GRCm39) missense probably damaging 0.99
IGL00573:Nlrp3 APN 11 59,455,942 (GRCm39) missense possibly damaging 0.93
IGL01025:Nlrp3 APN 11 59,442,713 (GRCm39) missense probably benign 0.21
IGL01637:Nlrp3 APN 11 59,440,204 (GRCm39) missense probably damaging 0.99
IGL02010:Nlrp3 APN 11 59,440,361 (GRCm39) missense probably benign
IGL02334:Nlrp3 APN 11 59,455,909 (GRCm39) missense probably benign
IGL02417:Nlrp3 APN 11 59,456,849 (GRCm39) unclassified probably benign
IGL02578:Nlrp3 APN 11 59,439,227 (GRCm39) missense probably damaging 1.00
IGL02710:Nlrp3 APN 11 59,456,802 (GRCm39) missense probably damaging 0.99
IGL02816:Nlrp3 APN 11 59,446,608 (GRCm39) missense probably benign 0.03
IGL03157:Nlrp3 APN 11 59,440,372 (GRCm39) missense possibly damaging 0.80
IGL03334:Nlrp3 APN 11 59,439,842 (GRCm39) missense probably damaging 1.00
Flogiston UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
nd1 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
Nd14 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd3 UTSW 11 59,456,800 (GRCm39) missense probably benign 0.45
nd5 UTSW 11 59,456,705 (GRCm39) missense probably benign 0.01
nd6 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
nd7 UTSW 11 59,446,701 (GRCm39) missense possibly damaging 0.89
Nd9 UTSW 11 59,440,180 (GRCm39) missense probably damaging 1.00
Park2 UTSW 11 59,455,954 (GRCm39) nonsense probably null
Park3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
Park4 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
Park5 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
Park6 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
Park7 UTSW 11 59,438,836 (GRCm39) nonsense probably null
Park8 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0008:Nlrp3 UTSW 11 59,449,274 (GRCm39) missense probably benign 0.00
R0052:Nlrp3 UTSW 11 59,455,954 (GRCm39) nonsense probably null
R0362:Nlrp3 UTSW 11 59,439,623 (GRCm39) missense possibly damaging 0.49
R0416:Nlrp3 UTSW 11 59,446,750 (GRCm39) splice site probably benign
R0649:Nlrp3 UTSW 11 59,439,368 (GRCm39) missense possibly damaging 0.83
R0740:Nlrp3 UTSW 11 59,439,082 (GRCm39) missense probably benign 0.01
R0863:Nlrp3 UTSW 11 59,456,676 (GRCm39) missense probably benign 0.02
R1300:Nlrp3 UTSW 11 59,446,594 (GRCm39) missense possibly damaging 0.86
R1414:Nlrp3 UTSW 11 59,440,357 (GRCm39) missense probably benign 0.19
R1622:Nlrp3 UTSW 11 59,439,302 (GRCm39) missense probably damaging 0.99
R1715:Nlrp3 UTSW 11 59,434,177 (GRCm39) missense probably damaging 1.00
R1754:Nlrp3 UTSW 11 59,449,228 (GRCm39) missense possibly damaging 0.80
R1837:Nlrp3 UTSW 11 59,439,742 (GRCm39) missense probably benign 0.00
R1905:Nlrp3 UTSW 11 59,439,862 (GRCm39) missense probably damaging 1.00
R2281:Nlrp3 UTSW 11 59,439,962 (GRCm39) missense possibly damaging 0.70
R4296:Nlrp3 UTSW 11 59,440,487 (GRCm39) missense possibly damaging 0.89
R4305:Nlrp3 UTSW 11 59,438,836 (GRCm39) nonsense probably null
R4540:Nlrp3 UTSW 11 59,442,725 (GRCm39) missense possibly damaging 0.83
R4591:Nlrp3 UTSW 11 59,440,048 (GRCm39) missense probably benign 0.00
R4816:Nlrp3 UTSW 11 59,439,127 (GRCm39) missense probably benign 0.32
R4913:Nlrp3 UTSW 11 59,440,064 (GRCm39) missense probably benign 0.09
R4970:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5051:Nlrp3 UTSW 11 59,457,025 (GRCm39) missense probably benign 0.19
R5112:Nlrp3 UTSW 11 59,439,554 (GRCm39) missense probably damaging 1.00
R5185:Nlrp3 UTSW 11 59,455,910 (GRCm39) missense probably benign 0.05
R5417:Nlrp3 UTSW 11 59,439,889 (GRCm39) missense probably damaging 1.00
R5709:Nlrp3 UTSW 11 59,446,574 (GRCm39) nonsense probably null
R5869:Nlrp3 UTSW 11 59,438,960 (GRCm39) missense probably damaging 1.00
R5898:Nlrp3 UTSW 11 59,437,678 (GRCm39) missense probably benign 0.00
R5953:Nlrp3 UTSW 11 59,437,617 (GRCm39) missense probably benign
R5979:Nlrp3 UTSW 11 59,439,797 (GRCm39) missense probably benign 0.06
R6359:Nlrp3 UTSW 11 59,439,392 (GRCm39) missense probably damaging 0.97
R6723:Nlrp3 UTSW 11 59,456,018 (GRCm39) missense probably damaging 1.00
R7261:Nlrp3 UTSW 11 59,439,272 (GRCm39) missense possibly damaging 0.83
R7349:Nlrp3 UTSW 11 59,438,912 (GRCm39) missense probably damaging 1.00
R7388:Nlrp3 UTSW 11 59,455,892 (GRCm39) missense probably benign 0.00
R7715:Nlrp3 UTSW 11 59,433,829 (GRCm39) splice site probably null
R7916:Nlrp3 UTSW 11 59,442,689 (GRCm39) missense probably benign 0.00
R8222:Nlrp3 UTSW 11 59,439,614 (GRCm39) missense probably damaging 0.98
R8360:Nlrp3 UTSW 11 59,440,229 (GRCm39) missense probably benign 0.02
R8390:Nlrp3 UTSW 11 59,442,616 (GRCm39) missense possibly damaging 0.47
R8550:Nlrp3 UTSW 11 59,440,097 (GRCm39) missense probably damaging 1.00
R8738:Nlrp3 UTSW 11 59,440,216 (GRCm39) missense probably benign 0.00
R8940:Nlrp3 UTSW 11 59,455,870 (GRCm39) missense probably benign 0.26
R8990:Nlrp3 UTSW 11 59,439,584 (GRCm39) missense probably damaging 0.99
R9324:Nlrp3 UTSW 11 59,434,141 (GRCm39) missense probably damaging 1.00
R9673:Nlrp3 UTSW 11 59,440,148 (GRCm39) missense probably damaging 1.00
RF031:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
RF040:Nlrp3 UTSW 11 59,449,378 (GRCm39) frame shift probably null
Z1088:Nlrp3 UTSW 11 59,442,686 (GRCm39) missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- CTCAGGACATACGTCTGGATCAAGC -3'
(R):5'- TCGCCTGTTGATCGCAGCAAAG -3'

Sequencing Primer
(F):5'- AAACCTGTACCAATCTATGGGG -3'
(R):5'- GTTGATCGCAGCAAAGATCCAC -3'
Posted On 2014-05-09