Incidental Mutation 'R1654:Zbtb4'
ID188958
Institutional Source Beutler Lab
Gene Symbol Zbtb4
Ensembl Gene ENSMUSG00000018750
Gene Namezinc finger and BTB domain containing 4
Synonyms9230111I22Rik, 2310026P19Rik
MMRRC Submission 039690-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1654 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69765912-69784023 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 69779169 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 906 (A906D)
Ref Sequence ENSEMBL: ENSMUSP00000104280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045971] [ENSMUST00000108638] [ENSMUST00000108639] [ENSMUST00000108640] [ENSMUST00000108642] [ENSMUST00000132528] [ENSMUST00000153943] [ENSMUST00000156932]
Predicted Effect probably benign
Transcript: ENSMUST00000045971
SMART Domains Protein: ENSMUSP00000047270
Gene: ENSMUSG00000041189

DomainStartEndE-ValueType
low complexity region 2 21 N/A INTRINSIC
Pfam:Neur_chan_LBD 27 245 3.6e-65 PFAM
Pfam:Neur_chan_memb 252 487 3.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108638
SMART Domains Protein: ENSMUSP00000104278
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000108639
AA Change: A906D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104279
Gene: ENSMUSG00000018750
AA Change: A906D

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108640
AA Change: A906D

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000104280
Gene: ENSMUSG00000018750
AA Change: A906D

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
ZnF_C2H2 210 230 1.91e1 SMART
low complexity region 240 261 N/A INTRINSIC
low complexity region 274 283 N/A INTRINSIC
ZnF_C2H2 285 307 1.53e-1 SMART
ZnF_C2H2 313 335 1.91e1 SMART
ZnF_C2H2 341 364 5.81e-2 SMART
low complexity region 422 445 N/A INTRINSIC
low complexity region 461 482 N/A INTRINSIC
low complexity region 485 532 N/A INTRINSIC
low complexity region 551 568 N/A INTRINSIC
coiled coil region 601 637 N/A INTRINSIC
low complexity region 650 662 N/A INTRINSIC
low complexity region 664 673 N/A INTRINSIC
ZnF_C2H2 700 722 3.78e-1 SMART
ZnF_C2H2 739 761 6.23e-2 SMART
low complexity region 799 820 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108642
SMART Domains Protein: ENSMUSP00000104282
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
BTB 30 166 2e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000132528
SMART Domains Protein: ENSMUSP00000121694
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 56 6.6e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000153943
SMART Domains Protein: ENSMUSP00000118027
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 5.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000156932
SMART Domains Protein: ENSMUSP00000115687
Gene: ENSMUSG00000018750

DomainStartEndE-ValueType
Pfam:BTB 20 51 6e-8 PFAM
low complexity region 68 85 N/A INTRINSIC
low complexity region 123 136 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.4%
  • 10x: 96.5%
  • 20x: 93.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700012B07Rik C T 11: 109,797,399 S90N probably benign Het
Apc2 C T 10: 80,301,842 T39I possibly damaging Het
Arfgef3 C T 10: 18,625,148 R1118K probably null Het
Arhgef12 T C 9: 42,997,660 D658G possibly damaging Het
Asph G T 4: 9,453,315 R736S probably benign Het
Bcas1 C T 2: 170,349,246 G542E probably damaging Het
Brd8 A T 18: 34,611,226 V183E probably damaging Het
C1rl G A 6: 124,493,910 G59E probably damaging Het
Cacna1i C A 15: 80,389,210 A1699D probably damaging Het
Card6 G T 15: 5,098,732 Q1061K probably benign Het
Cd163 G T 6: 124,317,581 C566F probably damaging Het
Cd84 C T 1: 171,884,606 T263I possibly damaging Het
Cep63 T C 9: 102,586,913 I740V possibly damaging Het
Chaf1b C A 16: 93,894,903 A279D probably damaging Het
Chsy3 A T 18: 59,176,416 Y247F probably damaging Het
Cpxm1 G A 2: 130,393,546 L509F possibly damaging Het
Disc1 A T 8: 125,148,465 Q558L possibly damaging Het
Dnah3 A T 7: 119,926,449 L3894Q probably damaging Het
Dnmt1 G T 9: 20,936,574 T105N possibly damaging Het
Dock6 A T 9: 21,804,843 L1732Q probably damaging Het
Dsc2 T C 18: 20,046,246 N255S probably benign Het
Dsel A T 1: 111,862,512 Y98N probably damaging Het
Enox1 T A 14: 77,611,374 I375N possibly damaging Het
Epha4 T A 1: 77,374,768 probably null Het
Fam71a T C 1: 191,163,481 R322G probably benign Het
Fktn A G 4: 53,761,220 I446V probably benign Het
Gm7361 G T 5: 26,261,099 R153L probably damaging Het
Grin2c C T 11: 115,260,853 V94I probably benign Het
Kalrn T G 16: 33,975,738 L1222F probably damaging Het
Krt80 T C 15: 101,351,709 K255E probably damaging Het
Lcn6 T A 2: 25,680,775 probably null Het
Lonp2 T G 8: 86,631,450 L100V probably damaging Het
Lyn G A 4: 3,789,912 A482T probably damaging Het
Mapk4 A G 18: 73,930,939 F404S probably damaging Het
Mast2 T C 4: 116,316,550 probably null Het
Medag T C 5: 149,422,135 Y94H probably damaging Het
Megf8 T C 7: 25,338,486 L809P possibly damaging Het
Mgam T C 6: 40,757,487 S743P probably damaging Het
Mia2 C A 12: 59,108,833 T445K possibly damaging Het
Nars C G 18: 64,512,049 A43P probably damaging Het
Nav3 T C 10: 109,853,123 N431S possibly damaging Het
Ndufaf5 A G 2: 140,177,300 probably null Het
Nlrp1b T G 11: 71,181,298 E573A probably damaging Het
Nlrp3 T C 11: 59,543,123 V4A probably benign Het
Olfr1389 G A 11: 49,430,502 G9R probably benign Het
Olfr194 T C 16: 59,119,689 N127S possibly damaging Het
Olfr661 A T 7: 104,688,213 Y66F probably benign Het
Pcdhb12 A T 18: 37,436,701 D300V probably damaging Het
Pik3c2a A T 7: 116,368,848 C804S probably benign Het
Pkp4 A T 2: 59,337,619 Q725L probably damaging Het
Ptpre T A 7: 135,653,928 S119T probably benign Het
Ptprk G A 10: 28,383,647 R361H probably damaging Het
Ptprr T C 10: 116,188,363 V193A probably benign Het
Rfx2 C T 17: 56,808,263 A19T probably benign Het
Rgs4 T A 1: 169,745,311 M19L probably benign Het
Rnf157 T C 11: 116,358,715 H225R probably damaging Het
Rnf44 A T 13: 54,681,779 D341E possibly damaging Het
Sct T A 7: 141,278,854 Q55L probably damaging Het
Sh3rf1 A T 8: 61,361,745 H446L possibly damaging Het
Shisa3 A T 5: 67,611,059 I101F probably damaging Het
Slc6a13 A G 6: 121,336,926 I543V probably benign Het
Soga3 A T 10: 29,146,935 probably null Het
Spef2 G A 15: 9,634,652 A1024V probably damaging Het
St6galnac6 T C 2: 32,619,509 S330P probably damaging Het
Stard9 G T 2: 120,703,722 A3487S probably benign Het
Suclg2 T C 6: 95,655,551 S46G probably damaging Het
Syne2 T C 12: 76,101,094 V6469A possibly damaging Het
Tada2b C T 5: 36,483,795 G88D probably damaging Het
Tll1 A T 8: 64,117,903 probably null Het
Tph2 T A 10: 115,184,807 H28L probably benign Het
Trmt6 C A 2: 132,815,835 V34L possibly damaging Het
Ttc22 A G 4: 106,634,211 T204A probably damaging Het
Umodl1 A T 17: 30,987,968 M778L probably benign Het
Vcan T C 13: 89,661,946 H2282R probably damaging Het
Vmn2r77 T A 7: 86,811,915 S816R probably damaging Het
Vps13c T A 9: 67,951,687 F2806L probably damaging Het
Zscan29 A G 2: 121,164,779 V421A probably benign Het
Other mutations in Zbtb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Zbtb4 APN 11 69776731 nonsense probably null
IGL02178:Zbtb4 APN 11 69776429 nonsense probably null
R0092:Zbtb4 UTSW 11 69779351 missense probably benign
R0403:Zbtb4 UTSW 11 69777639 missense probably damaging 0.99
R1276:Zbtb4 UTSW 11 69776219 missense probably damaging 1.00
R1734:Zbtb4 UTSW 11 69776463 missense probably benign 0.13
R1762:Zbtb4 UTSW 11 69778917 missense probably benign 0.03
R2224:Zbtb4 UTSW 11 69776358 missense probably benign 0.43
R2930:Zbtb4 UTSW 11 69776516 nonsense probably null
R4670:Zbtb4 UTSW 11 69776529 missense probably damaging 0.97
R4998:Zbtb4 UTSW 11 69778671 missense probably benign 0.31
R5956:Zbtb4 UTSW 11 69778214 missense probably benign 0.29
R5988:Zbtb4 UTSW 11 69778964 missense probably damaging 1.00
R6115:Zbtb4 UTSW 11 69776322 missense probably damaging 1.00
R6237:Zbtb4 UTSW 11 69778243 missense possibly damaging 0.70
R6803:Zbtb4 UTSW 11 69778628 missense possibly damaging 0.92
R7395:Zbtb4 UTSW 11 69776111 missense possibly damaging 0.58
R7756:Zbtb4 UTSW 11 69778542 missense probably benign 0.27
R7758:Zbtb4 UTSW 11 69778542 missense probably benign 0.27
R7877:Zbtb4 UTSW 11 69776037 missense probably benign 0.39
R7960:Zbtb4 UTSW 11 69776037 missense probably benign 0.39
Predicted Primers PCR Primer
(F):5'- GAGATGCAAGTGTCCTCTTCCAGTG -3'
(R):5'- AATCCCTGCACAAGAGTGTGATGG -3'

Sequencing Primer
(F):5'- GGCAGCTATGTATACCCACCTG -3'
(R):5'- GGACCTGGCCTTGTTGC -3'
Posted On2014-05-09