Mutagenetix > Incidental Mutations

Incidental Mutation 'R1655:Serpinb3a'

188993

Institutional Source

Beutler Lab

Gene Symbol

Serpinb3a

Ensembl Gene

ENSMUSG00000044594

Gene Name

serine (or cysteine) peptidase inhibitor, clade B (ovalbumin), member 3A

Synonyms

Sqn5

MMRRC Submission

039691-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.071) question?

Stock #

R1655 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

107045587-107052303 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 107046212 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 323 (V323A)

Ref Sequence

ENSEMBL: ENSMUSP00000108337 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000027567] [ENSMUST00000112717]

Predicted Effect

probably damaging
Transcript: ENSMUST00000027567
AA Change: V323A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000027567
Gene: ENSMUSG00000044594
AA Change: V323A

Domain	Start	End	E-Value	Type
SERPIN	13	387	6.36e-182	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000112717
AA Change: V323A

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000108337
Gene: ENSMUSG00000044594
AA Change: V323A

Domain	Start	End	E-Value	Type
SERPIN	13	387	6.36e-182	SMART

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the serpin family of serine protease inhibitors. The encoded protein is highly expressed in many tumor cells and can inactivate granzyme M, an enzyme that kills tumor cells. This protein, along with serpin B3, can be processed into smaller fragments that aggregate to form an autoantigen in psoriasis, probably by causing chronic inflammation. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced susceptibility to allergen-induced airway hyperresponsiveness. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cfap46	A	T	7: 139,642,520	Y1180*	probably null	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Crtc3	A	T	7: 80,598,776	M313K	possibly damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Disp1	A	T	1: 183,087,004	I1284N	probably benign	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rictor	T	A	15: 6,772,212	D460E	probably benign	Het
Rpn1	T	C	6: 88,100,944	V454A	possibly damaging	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Top1	T	A	2: 160,703,696		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Serpinb3a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01113:Serpinb3a	APN	1	107051059	nonsense	probably null
IGL01940:Serpinb3a	APN	1	107046185	missense	probably damaging	1.00
IGL02077:Serpinb3a	APN	1	107046381	missense	probably damaging	0.99
IGL02136:Serpinb3a	APN	1	107046285	missense	probably benign	0.15
IGL02214:Serpinb3a	APN	1	107048488	critical splice donor site	probably null
IGL02239:Serpinb3a	APN	1	107051688	missense	probably benign	0.05
IGL02508:Serpinb3a	APN	1	107046072	missense	probably damaging	1.00
IGL02533:Serpinb3a	APN	1	107047162	missense	probably benign	0.00
IGL02860:Serpinb3a	APN	1	107049453	splice site	probably benign
IGL03013:Serpinb3a	APN	1	107046083	missense	probably damaging	1.00
IGL03391:Serpinb3a	APN	1	107046342	missense	possibly damaging	0.81
R0321:Serpinb3a	UTSW	1	107047482	nonsense	probably null
R0416:Serpinb3a	UTSW	1	107049386	missense	probably benign	0.29
R0494:Serpinb3a	UTSW	1	107047482	nonsense	probably null
R0498:Serpinb3a	UTSW	1	107047150	missense	probably damaging	1.00
R1223:Serpinb3a	UTSW	1	107047552	missense	probably damaging	1.00
R1596:Serpinb3a	UTSW	1	107047174	missense	probably benign	0.12
R2156:Serpinb3a	UTSW	1	107047472	critical splice donor site	probably null
R2296:Serpinb3a	UTSW	1	107047561	missense	probably damaging	1.00
R4327:Serpinb3a	UTSW	1	107051770	start codon destroyed	probably damaging	1.00
R4612:Serpinb3a	UTSW	1	107047607	missense	probably damaging	0.99
R4830:Serpinb3a	UTSW	1	107048586	missense	probably benign	0.00
R5016:Serpinb3a	UTSW	1	107046330	missense	probably damaging	1.00
R5483:Serpinb3a	UTSW	1	107047169	missense	probably benign	0.16
R5619:Serpinb3a	UTSW	1	107047108	missense	probably damaging	1.00
R7227:Serpinb3a	UTSW	1	107051629	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- ACATCTAAGGGGAGGAGATTCTGCC -3'
(R):5'- ACAACTCACTGCTGACAAGTTACTGG -3'

Sequencing Primer
(F):5'- TTCTGCCAAAGAAGAGGATGC -3'
(R):5'- CTGACAAGTTACTGGAGTGGAC -3'

Posted On

2014-05-09