Incidental Mutation 'R1655:Mr1'
ID 188995
Institutional Source Beutler Lab
Gene Symbol Mr1
Ensembl Gene ENSMUSG00000026471
Gene Name major histocompatibility complex, class I-related
Synonyms H2ls, MR1
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock # R1655 (G1)
Quality Score 225
Status Not validated
Chromosome 1
Chromosomal Location 155127277-155146814 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) G to A at 155132455 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 258 (T258M)
Ref Sequence ENSEMBL: ENSMUSP00000027744 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027744] [ENSMUST00000192410] [ENSMUST00000194612]
AlphaFold Q8HWB0
Predicted Effect probably benign
Transcript: ENSMUST00000027744
AA Change: T258M

PolyPhen 2 Score 0.052 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000027744
Gene: ENSMUSG00000026471
AA Change: T258M

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 194 1.8e-59 PFAM
Pfam:MHC_I_3 46 193 3.9e-12 PFAM
IGc1 213 284 1.51e-12 SMART
transmembrane domain 297 319 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191773
Predicted Effect probably benign
Transcript: ENSMUST00000192410
SMART Domains Protein: ENSMUSP00000141476
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:MHC_I 19 87 8e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194612
SMART Domains Protein: ENSMUSP00000142195
Gene: ENSMUSG00000026471

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
PDB:4NQE|C 19 44 3e-7 PDB
SCOP:d1de4a2 19 44 3e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195579
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MAIT (mucosal-associated invariant T-cells) lymphocytes represent a small population of T-cells primarily found in the gut. The protein encoded by this gene is an antigen-presenting molecule that presents metabolites of microbial vitamin B to MAITs. This presentation may activate the MAITs to regulate the amounts of specific types of bacteria in the gut. Several transcript variants encoding different isoforms have been found for this gene, and a pseudogene of it has been detected about 36 kbp upstream on the same chromosome. [provided by RefSeq, Jul 2015]
PHENOTYPE: Null homozyogtes lack mucosal-associated invariant T cells that express the canonical mVa19-Ja33 rearrangement of the Tcra gene. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Mr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03216:Mr1 APN 1 155129289 missense possibly damaging 0.51
R0612:Mr1 UTSW 1 155137690 missense probably damaging 1.00
R1388:Mr1 UTSW 1 155132503 missense probably damaging 0.98
R2157:Mr1 UTSW 1 155146630 critical splice donor site probably null
R2437:Mr1 UTSW 1 155132531 missense probably benign 0.07
R3421:Mr1 UTSW 1 155137591 missense probably damaging 1.00
R4224:Mr1 UTSW 1 155130719 missense possibly damaging 0.62
R4240:Mr1 UTSW 1 155136667 missense probably damaging 1.00
R4711:Mr1 UTSW 1 155136590 missense probably benign 0.00
R4849:Mr1 UTSW 1 155130690 missense probably benign 0.00
R5915:Mr1 UTSW 1 155136788 missense probably damaging 1.00
R6882:Mr1 UTSW 1 155132453 missense possibly damaging 0.54
R6940:Mr1 UTSW 1 155129268 makesense probably null
R7315:Mr1 UTSW 1 155129290 missense probably benign
R7567:Mr1 UTSW 1 155146728 start gained probably benign
R7751:Mr1 UTSW 1 155129308 missense probably damaging 1.00
R7818:Mr1 UTSW 1 155130636 nonsense probably null
R9250:Mr1 UTSW 1 155137579 missense probably damaging 1.00
R9284:Mr1 UTSW 1 155137528 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- ACCTGGTGAAGCCTGTGGTGAC -3'
(R):5'- TTGCCTACGGCATGGGAGGAAG -3'

Sequencing Primer
(F):5'- AGTGACCCAGCATCCCTTC -3'
(R):5'- GTGGTAAGTTCAGTATCCAAGACCC -3'
Posted On 2014-05-09