Mutagenetix > Incidental Mutations

Incidental Mutation 'R1655:Disp1'

188996

Institutional Source

Beutler Lab

Gene Symbol

Disp1

Ensembl Gene

ENSMUSG00000030768

Gene Name

dispatched RND transporter family member 1

Synonyms

1190008H24Rik, DispA

MMRRC Submission

039691-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.943) question?

Stock #

R1655 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

183086266-183221522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 183087004 bp

Zygosity

Heterozygous

Amino Acid Change

Isoleucine to Asparagine at position 1284 (I1284N)

Ref Sequence

ENSEMBL: ENSMUSP00000141747 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000003035] [ENSMUST00000171366] [ENSMUST00000195372]

Predicted Effect

probably benign
Transcript: ENSMUST00000003035
AA Change: I1284N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000003035
Gene: ENSMUSG00000030768
AA Change: I1284N

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	279	765	6.8e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	518	670	1.7e-15	PFAM
Pfam:Patched	916	1130	8e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000171366
AA Change: I1284N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000126742
Gene: ENSMUSG00000030768
AA Change: I1284N

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000195372
AA Change: I1284N

PolyPhen 2 Score 0.009 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000141747
Gene: ENSMUSG00000030768
AA Change: I1284N

Domain	Start	End	E-Value	Type
low complexity region	11	35	N/A	INTRINSIC
low complexity region	71	89	N/A	INTRINSIC
transmembrane domain	187	209	N/A	INTRINSIC
Pfam:Patched	272	766	2.6e-20	PFAM
Pfam:MMPL	496	691	6.6e-13	PFAM
Pfam:Sterol-sensing	516	671	2.2e-15	PFAM
Pfam:Patched	921	1130	8.7e-11	PFAM
Pfam:MMPL	937	1144	3.9e-9	PFAM

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The pattern of cellular proliferation and differentiation that leads to normal development of embryonic structures often depends upon the localized production of secreted protein signals. Cells surrounding the source of a particular signal respond in a graded manner according to the effective concentration of the signal, and this response produces the pattern of cell types constituting the mature structure. A novel segment-polarity gene known as dispatched has been identified in Drosophila and its protein product is required for normal Hedgehog (Hh) signaling. This gene is one of two human homologs of Drosophila dispatched and, based on sequence identity to its mouse counterpart, the encoded protein may play an essential role in Hh patterning activities in the early embryo. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for targeted and chemically induced mutations exhibit a dorsalized neural tube, impaired heart looping, pericardial edema, large forelimbs, and abnormal head shape. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cfap46	A	T	7: 139,642,520	Y1180*	probably null	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Crtc3	A	T	7: 80,598,776	M313K	possibly damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rictor	T	A	15: 6,772,212	D460E	probably benign	Het
Rpn1	T	C	6: 88,100,944	V454A	possibly damaging	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Serpinb3a	A	G	1: 107,046,212	V323A	probably damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Top1	T	A	2: 160,703,696		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Disp1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
BB006:Disp1	UTSW	1	183135539	missense	probably benign
BB016:Disp1	UTSW	1	183135539	missense	probably benign
R1120:Disp1	UTSW	1	183098575	missense	probably benign	0.24
R1482:Disp1	UTSW	1	183086474	missense	possibly damaging	0.61
R1660:Disp1	UTSW	1	183087742	missense	probably damaging	1.00
R1816:Disp1	UTSW	1	183098575	missense	probably damaging	0.99
R1835:Disp1	UTSW	1	183089000	missense	probably damaging	1.00
R1954:Disp1	UTSW	1	183088543	missense	probably damaging	0.99
R2025:Disp1	UTSW	1	183088203	missense	probably damaging	1.00
R2136:Disp1	UTSW	1	183088378	missense	probably damaging	1.00
R2150:Disp1	UTSW	1	183088372	missense	probably damaging	1.00
R2207:Disp1	UTSW	1	183088342	missense	possibly damaging	0.94
R2392:Disp1	UTSW	1	183087167	missense	probably benign
R2831:Disp1	UTSW	1	183089319	small deletion	probably benign
R3111:Disp1	UTSW	1	183087523	missense	probably damaging	1.00
R3116:Disp1	UTSW	1	183088922	missense	probably benign	0.01
R3160:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3161:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3162:Disp1	UTSW	1	183087242	missense	probably benign	0.09
R3716:Disp1	UTSW	1	183087751	missense	probably damaging	1.00
R3914:Disp1	UTSW	1	183089102	missense	probably benign	0.05
R4061:Disp1	UTSW	1	183087700	missense	probably damaging	0.96
R4191:Disp1	UTSW	1	183089173	missense	probably damaging	1.00
R4261:Disp1	UTSW	1	183089386	missense	probably damaging	1.00
R4272:Disp1	UTSW	1	183087644	missense	possibly damaging	0.95
R4273:Disp1	UTSW	1	183087644	missense	possibly damaging	0.95
R4351:Disp1	UTSW	1	183099978	missense	probably benign	0.01
R4672:Disp1	UTSW	1	183098651	critical splice acceptor site	probably null
R4764:Disp1	UTSW	1	183088096	missense	probably damaging	1.00
R4910:Disp1	UTSW	1	183135463	missense	probably damaging	1.00
R5150:Disp1	UTSW	1	183089499	missense	probably damaging	0.98
R5502:Disp1	UTSW	1	183087886	missense	probably damaging	1.00
R5616:Disp1	UTSW	1	183088349	missense	probably benign	0.30
R5699:Disp1	UTSW	1	183088555	nonsense	probably null
R5813:Disp1	UTSW	1	183088410	missense	probably damaging	1.00
R5820:Disp1	UTSW	1	183135587	missense	probably benign	0.00
R6184:Disp1	UTSW	1	183086332	missense	probably benign	0.00
R6228:Disp1	UTSW	1	183099025	missense	possibly damaging	0.59
R6306:Disp1	UTSW	1	183087148	missense	possibly damaging	0.93
R6505:Disp1	UTSW	1	183086512	missense	probably benign	0.02
R6925:Disp1	UTSW	1	183086478	missense	probably benign
R7016:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7045:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7046:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7047:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7114:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7123:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7124:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7125:Disp1	UTSW	1	183087466	missense	probably damaging	1.00
R7161:Disp1	UTSW	1	183087625	missense	possibly damaging	0.84
R7510:Disp1	UTSW	1	183088411	missense	probably damaging	1.00
R7756:Disp1	UTSW	1	183089734	missense	probably damaging	1.00
R7800:Disp1	UTSW	1	183098986	missense	probably benign	0.00
R7929:Disp1	UTSW	1	183135539	missense	probably benign
R8029:Disp1	UTSW	1	183089288	missense	probably damaging	1.00
R8036:Disp1	UTSW	1	183089239	missense	probably damaging	1.00
R8045:Disp1	UTSW	1	183089230	missense	probably damaging	1.00
R8054:Disp1	UTSW	1	183088248	nonsense	probably null
R8061:Disp1	UTSW	1	183087587	missense	probably damaging	1.00
R8094:Disp1	UTSW	1	183087628	missense	probably damaging	1.00
R8130:Disp1	UTSW	1	183135635	missense	probably benign	0.13

Predicted Primers

PCR Primer
(F):5'- TTTGGAAAGACTCAGTGCTCCTGC -3'
(R):5'- AGAATTTAAGGATGCCTGTGCCTGC -3'

Sequencing Primer
(F):5'- CCTGAAAGTGCTGCACTGAG -3'
(R):5'- TGCAGCCTACAGCAGCG -3'

Posted On

2014-05-09