Incidental Mutation 'R1655:Emilin3'
ID189003
Institutional Source Beutler Lab
Gene Symbol Emilin3
Ensembl Gene ENSMUSG00000050700
Gene Nameelastin microfibril interfacer 3
SynonymsEmilin5, EMILIN-T
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R1655 (G1)
Quality Score223
Status Not validated
Chromosome2
Chromosomal Location160906437-160912328 bp(-) (GRCm38)
Type of Mutationcritical splice acceptor site
DNA Base Change (assembly) T to A at 160910866 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000105080 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040872] [ENSMUST00000057169] [ENSMUST00000109454] [ENSMUST00000109455] [ENSMUST00000109456]
Predicted Effect probably benign
Transcript: ENSMUST00000040872
SMART Domains Protein: ENSMUSP00000043053
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Predicted Effect probably null
Transcript: ENSMUST00000057169
SMART Domains Protein: ENSMUSP00000059732
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 55 125 7.3e-18 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 281 295 N/A INTRINSIC
low complexity region 359 381 N/A INTRINSIC
low complexity region 451 460 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000109454
SMART Domains Protein: ENSMUSP00000105080
Gene: ENSMUSG00000050700

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:EMI 54 127 6.4e-22 PFAM
low complexity region 144 161 N/A INTRINSIC
low complexity region 234 248 N/A INTRINSIC
low complexity region 312 334 N/A INTRINSIC
low complexity region 404 413 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109455
SMART Domains Protein: ENSMUSP00000105081
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 2.4e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 528 538 N/A INTRINSIC
LNS2 606 762 1.4e-105 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109456
SMART Domains Protein: ENSMUSP00000105082
Gene: ENSMUSG00000027412

DomainStartEndE-ValueType
Pfam:Lipin_N 1 114 5.8e-52 PFAM
low complexity region 136 148 N/A INTRINSIC
low complexity region 155 172 N/A INTRINSIC
low complexity region 176 191 N/A INTRINSIC
low complexity region 220 233 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 559 569 N/A INTRINSIC
LNS2 637 793 1.4e-105 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Emilin3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01104:Emilin3 APN 2 160909783 missense probably damaging 1.00
IGL02231:Emilin3 APN 2 160908515 missense probably damaging 1.00
IGL02812:Emilin3 APN 2 160908729 nonsense probably null
IGL02813:Emilin3 APN 2 160908729 nonsense probably null
IGL02892:Emilin3 APN 2 160909149 missense possibly damaging 0.72
IGL03012:Emilin3 APN 2 160908729 nonsense probably null
IGL03017:Emilin3 APN 2 160908729 nonsense probably null
IGL03083:Emilin3 APN 2 160908729 nonsense probably null
IGL03094:Emilin3 APN 2 160908729 nonsense probably null
IGL03163:Emilin3 APN 2 160908729 nonsense probably null
IGL03206:Emilin3 APN 2 160910799 missense probably damaging 1.00
IGL02835:Emilin3 UTSW 2 160908729 nonsense probably null
IGL03046:Emilin3 UTSW 2 160908729 nonsense probably null
PIT1430001:Emilin3 UTSW 2 160908482 missense possibly damaging 0.48
R0373:Emilin3 UTSW 2 160909817 missense probably benign 0.00
R0392:Emilin3 UTSW 2 160910879 unclassified probably benign
R0420:Emilin3 UTSW 2 160910879 unclassified probably benign
R0627:Emilin3 UTSW 2 160908176 missense probably damaging 1.00
R0628:Emilin3 UTSW 2 160910879 unclassified probably benign
R0671:Emilin3 UTSW 2 160908329 missense probably damaging 1.00
R2016:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R2017:Emilin3 UTSW 2 160909610 missense possibly damaging 0.85
R3624:Emilin3 UTSW 2 160908257 missense possibly damaging 0.59
R4062:Emilin3 UTSW 2 160907796 missense probably benign
R4307:Emilin3 UTSW 2 160908317 missense probably damaging 1.00
R4365:Emilin3 UTSW 2 160908486 missense probably benign
R4669:Emilin3 UTSW 2 160910797 missense probably benign 0.00
R5076:Emilin3 UTSW 2 160909318 critical splice acceptor site probably null
R5227:Emilin3 UTSW 2 160909265 missense probably damaging 1.00
R5725:Emilin3 UTSW 2 160908490 nonsense probably null
R5914:Emilin3 UTSW 2 160909070 missense probably damaging 1.00
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6030:Emilin3 UTSW 2 160909185 missense probably benign
R6919:Emilin3 UTSW 2 160908098 missense probably damaging 1.00
R7353:Emilin3 UTSW 2 160908821 missense probably damaging 0.99
R7618:Emilin3 UTSW 2 160909279 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TGTGGCCCAGATAGGTTCTCTGAAG -3'
(R):5'- TGGCTCAGTAGACAGTAGACACCC -3'

Sequencing Primer
(F):5'- CAGATAGGTTCTCTGAAGCCCAG -3'
(R):5'- GTAGACAGTAGACACCCATCAAGG -3'
Posted On2014-05-09