Incidental Mutation 'R1655:Clstn3'
ID 189019
Institutional Source Beutler Lab
Gene Symbol Clstn3
Ensembl Gene ENSMUSG00000008153
Gene Name calsyntenin 3
Synonyms Cst-3, CSTN3, alcadein-beta
MMRRC Submission 039691-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R1655 (G1)
Quality Score 163
Status Not validated
Chromosome 6
Chromosomal Location 124407715-124441743 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 124414386 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 743 (L743P)
Ref Sequence ENSEMBL: ENSMUSP00000108142 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008297] [ENSMUST00000112523]
AlphaFold Q99JH7
Predicted Effect probably damaging
Transcript: ENSMUST00000008297
AA Change: L780P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000008297
Gene: ENSMUSG00000008153
AA Change: L780P

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
CA 50 143 2.72e-12 SMART
CA 166 244 4.04e-2 SMART
SCOP:d1a8d_1 333 549 7e-23 SMART
transmembrane domain 846 868 N/A INTRINSIC
low complexity region 928 945 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000112523
AA Change: L743P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000108142
Gene: ENSMUSG00000008153
AA Change: L743P

DomainStartEndE-ValueType
CA 13 106 2.72e-12 SMART
CA 129 207 4.04e-2 SMART
Pfam:Laminin_G_3 304 505 4.1e-8 PFAM
transmembrane domain 809 831 N/A INTRINSIC
low complexity region 891 908 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124998
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143283
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147947
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit reductions in excitatory and inhibitory synapse density and deficits in synaptic transmission. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A T 14: 55,797,790 (GRCm39) probably benign Het
Abca1 C T 4: 53,050,964 (GRCm39) A1582T probably benign Het
Acot8 A T 2: 164,645,028 (GRCm39) S52T probably benign Het
Atcay C T 10: 81,049,231 (GRCm39) V124M probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cfap46 A T 7: 139,222,436 (GRCm39) Y1180* probably null Het
Clptm1 T A 7: 19,379,792 (GRCm39) H148L probably benign Het
Crtc3 A T 7: 80,248,524 (GRCm39) M313K possibly damaging Het
Csgalnact1 T A 8: 68,826,341 (GRCm39) I326F possibly damaging Het
Dennd6b G T 15: 89,080,543 (GRCm39) T19K unknown Het
Disp1 A T 1: 182,868,568 (GRCm39) I1284N probably benign Het
Dnah2 A G 11: 69,364,680 (GRCm39) Y1992H probably damaging Het
Dnah6 C T 6: 73,182,715 (GRCm39) V205I possibly damaging Het
Dst G T 1: 34,321,657 (GRCm39) G4391* probably null Het
Dytn A G 1: 63,700,357 (GRCm39) S258P probably damaging Het
Emilin3 T A 2: 160,752,786 (GRCm39) probably null Het
Ermn C T 2: 57,942,596 (GRCm39) V45I probably benign Het
Fat4 T C 3: 39,011,467 (GRCm39) V2189A probably damaging Het
Fcgbpl1 A T 7: 27,846,535 (GRCm39) N1076Y probably damaging Het
Filip1l T C 16: 57,392,214 (GRCm39) I934T probably damaging Het
Gbp9 T A 5: 105,229,558 (GRCm39) Q472L possibly damaging Het
Gimap5 G T 6: 48,730,110 (GRCm39) E227* probably null Het
Gsdmc C T 15: 63,651,892 (GRCm39) V240M probably benign Het
H2-Q4 G T 17: 35,601,881 (GRCm39) V248F probably damaging Het
Helz2 T C 2: 180,875,940 (GRCm39) E1518G probably damaging Het
Hmcn1 A G 1: 150,506,084 (GRCm39) V3814A probably benign Het
Hoatz A T 9: 50,994,921 (GRCm39) I136N probably damaging Het
Ifna7 A G 4: 88,734,897 (GRCm39) T145A probably benign Het
Itgam T A 7: 127,714,335 (GRCm39) M947K probably benign Het
Itpr2 T G 6: 146,277,646 (GRCm39) N608H probably damaging Het
Klra2 T A 6: 131,197,174 (GRCm39) N242I probably damaging Het
Lonrf2 A T 1: 38,850,905 (GRCm39) L219Q probably damaging Het
Ly6c2 T C 15: 74,980,412 (GRCm39) I126V probably benign Het
Mr1 G A 1: 155,008,201 (GRCm39) T258M probably benign Het
Mrps35 T G 6: 146,961,726 (GRCm39) D200E possibly damaging Het
Nbeal2 A C 9: 110,461,940 (GRCm39) S1506A probably damaging Het
Ncoa7 T C 10: 30,574,241 (GRCm39) probably null Het
Nlrp4a A T 7: 26,149,076 (GRCm39) I228F possibly damaging Het
Or13p5 A G 4: 118,592,196 (GRCm39) S157G probably benign Het
Or5c1 A G 2: 37,221,951 (GRCm39) Y64C probably damaging Het
Or5p59 A T 7: 107,702,671 (GRCm39) I52F probably damaging Het
Or8k3 A G 2: 86,058,424 (GRCm39) V297A possibly damaging Het
Paxx T C 2: 25,350,328 (GRCm39) E93G probably damaging Het
Per2 C A 1: 91,376,490 (GRCm39) G128W probably damaging Het
Piezo1 A G 8: 123,223,561 (GRCm39) I796T probably benign Het
Pkhd1 A G 1: 20,654,353 (GRCm39) S235P probably damaging Het
Pole T A 5: 110,483,788 (GRCm39) F259Y probably damaging Het
Pus7 T A 5: 23,952,798 (GRCm39) K512* probably null Het
Ralyl A T 3: 14,172,296 (GRCm39) Y55F probably damaging Het
Rgs14 T A 13: 55,531,347 (GRCm39) M451K probably benign Het
Rhag T C 17: 41,142,487 (GRCm39) F231L probably damaging Het
Ric8a T C 7: 140,440,808 (GRCm39) C94R probably benign Het
Rictor T A 15: 6,801,693 (GRCm39) D460E probably benign Het
Rpn1 T C 6: 88,077,926 (GRCm39) V454A possibly damaging Het
Sacs A G 14: 61,429,231 (GRCm39) D427G probably benign Het
Scai A T 2: 38,970,129 (GRCm39) V545D possibly damaging Het
Serpinb3a A G 1: 106,973,942 (GRCm39) V323A probably damaging Het
Slc13a5 C A 11: 72,148,204 (GRCm39) C277F probably benign Het
Slc15a1 A T 14: 121,703,311 (GRCm39) Y557N probably benign Het
Slc34a2 T C 5: 53,226,761 (GRCm39) V628A probably benign Het
Slc8a2 G T 7: 15,875,060 (GRCm39) G436V probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Supt5 T C 7: 28,029,449 (GRCm39) I103V probably benign Het
Tdrd1 T A 19: 56,831,648 (GRCm39) Y346* probably null Het
Tg T G 15: 66,700,417 (GRCm39) probably null Het
Top1 T A 2: 160,545,616 (GRCm39) probably null Het
Trmt12 T C 15: 58,745,076 (GRCm39) L158P probably damaging Het
Tssk4 A G 14: 55,889,152 (GRCm39) N226S probably damaging Het
Unc80 G T 1: 66,711,915 (GRCm39) V2746F possibly damaging Het
Usp34 T A 11: 23,325,051 (GRCm39) V999E probably benign Het
Virma T C 4: 11,494,786 (GRCm39) V29A probably damaging Het
Zfp40 A T 17: 23,396,240 (GRCm39) Y48N probably benign Het
Zfp609 A G 9: 65,610,836 (GRCm39) V709A possibly damaging Het
Other mutations in Clstn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01068:Clstn3 APN 6 124,439,098 (GRCm39) missense probably damaging 1.00
IGL01415:Clstn3 APN 6 124,415,781 (GRCm39) nonsense probably null
IGL01521:Clstn3 APN 6 124,434,990 (GRCm39) nonsense probably null
IGL01537:Clstn3 APN 6 124,408,559 (GRCm39) missense possibly damaging 0.91
IGL01729:Clstn3 APN 6 124,426,753 (GRCm39) missense probably benign 0.06
IGL01879:Clstn3 APN 6 124,415,769 (GRCm39) missense probably damaging 1.00
IGL01998:Clstn3 APN 6 124,435,622 (GRCm39) missense probably damaging 1.00
IGL03130:Clstn3 APN 6 124,436,222 (GRCm39) missense probably damaging 0.98
IGL03405:Clstn3 APN 6 124,415,327 (GRCm39) missense possibly damaging 0.95
PIT4403001:Clstn3 UTSW 6 124,434,982 (GRCm39) missense probably damaging 1.00
R0049:Clstn3 UTSW 6 124,436,812 (GRCm39) missense possibly damaging 0.87
R0049:Clstn3 UTSW 6 124,436,812 (GRCm39) missense possibly damaging 0.87
R0208:Clstn3 UTSW 6 124,409,128 (GRCm39) splice site probably benign
R0276:Clstn3 UTSW 6 124,408,699 (GRCm39) splice site probably benign
R0440:Clstn3 UTSW 6 124,428,372 (GRCm39) missense probably damaging 1.00
R0612:Clstn3 UTSW 6 124,426,459 (GRCm39) missense probably damaging 0.98
R1200:Clstn3 UTSW 6 124,436,129 (GRCm39) missense probably damaging 1.00
R1224:Clstn3 UTSW 6 124,434,878 (GRCm39) missense probably benign
R1378:Clstn3 UTSW 6 124,415,378 (GRCm39) missense probably damaging 1.00
R1491:Clstn3 UTSW 6 124,414,449 (GRCm39) missense possibly damaging 0.51
R1495:Clstn3 UTSW 6 124,426,876 (GRCm39) missense probably benign 0.00
R1511:Clstn3 UTSW 6 124,439,128 (GRCm39) missense probably damaging 1.00
R1731:Clstn3 UTSW 6 124,408,591 (GRCm39) missense probably benign 0.04
R1734:Clstn3 UTSW 6 124,413,773 (GRCm39) splice site probably benign
R1751:Clstn3 UTSW 6 124,408,958 (GRCm39) missense probably damaging 1.00
R1954:Clstn3 UTSW 6 124,436,257 (GRCm39) missense possibly damaging 0.94
R2133:Clstn3 UTSW 6 124,426,462 (GRCm39) missense probably benign
R2192:Clstn3 UTSW 6 124,436,166 (GRCm39) missense probably damaging 1.00
R2314:Clstn3 UTSW 6 124,427,676 (GRCm39) missense probably benign 0.39
R2874:Clstn3 UTSW 6 124,415,294 (GRCm39) missense probably damaging 1.00
R3500:Clstn3 UTSW 6 124,408,670 (GRCm39) missense probably benign 0.01
R3761:Clstn3 UTSW 6 124,434,835 (GRCm39) missense possibly damaging 0.54
R3878:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R3927:Clstn3 UTSW 6 124,428,327 (GRCm39) missense probably damaging 1.00
R3934:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R3935:Clstn3 UTSW 6 124,434,901 (GRCm39) missense probably damaging 0.97
R4063:Clstn3 UTSW 6 124,426,792 (GRCm39) missense possibly damaging 0.51
R4402:Clstn3 UTSW 6 124,433,939 (GRCm39) missense probably damaging 0.96
R4534:Clstn3 UTSW 6 124,436,179 (GRCm39) missense probably damaging 1.00
R4785:Clstn3 UTSW 6 124,414,331 (GRCm39) splice site probably null
R4834:Clstn3 UTSW 6 124,408,912 (GRCm39) splice site probably null
R5921:Clstn3 UTSW 6 124,408,539 (GRCm39) utr 3 prime probably benign
R5932:Clstn3 UTSW 6 124,415,291 (GRCm39) missense probably benign 0.01
R6025:Clstn3 UTSW 6 124,408,623 (GRCm39) missense possibly damaging 0.73
R6101:Clstn3 UTSW 6 124,438,629 (GRCm39) missense probably damaging 1.00
R6360:Clstn3 UTSW 6 124,415,388 (GRCm39) missense possibly damaging 0.88
R6578:Clstn3 UTSW 6 124,427,663 (GRCm39) critical splice donor site probably null
R6813:Clstn3 UTSW 6 124,413,894 (GRCm39) missense probably benign 0.00
R7380:Clstn3 UTSW 6 124,433,948 (GRCm39) missense probably benign 0.01
R7419:Clstn3 UTSW 6 124,435,088 (GRCm39) missense probably benign 0.05
R7625:Clstn3 UTSW 6 124,414,377 (GRCm39) nonsense probably null
R7780:Clstn3 UTSW 6 124,439,161 (GRCm39) missense probably damaging 0.98
R7936:Clstn3 UTSW 6 124,408,972 (GRCm39) missense possibly damaging 0.73
R7939:Clstn3 UTSW 6 124,439,158 (GRCm39) missense probably damaging 1.00
R8047:Clstn3 UTSW 6 124,408,972 (GRCm39) missense possibly damaging 0.73
R8079:Clstn3 UTSW 6 124,436,763 (GRCm39) missense probably damaging 1.00
R8085:Clstn3 UTSW 6 124,435,683 (GRCm39) missense probably benign 0.23
R8299:Clstn3 UTSW 6 124,414,332 (GRCm39) critical splice donor site probably null
R8406:Clstn3 UTSW 6 124,439,136 (GRCm39) missense probably damaging 1.00
R8685:Clstn3 UTSW 6 124,433,867 (GRCm39) missense probably damaging 1.00
R9045:Clstn3 UTSW 6 124,408,921 (GRCm39) missense probably damaging 0.98
R9209:Clstn3 UTSW 6 124,408,571 (GRCm39) missense probably benign 0.02
R9264:Clstn3 UTSW 6 124,436,727 (GRCm39) missense probably damaging 1.00
R9268:Clstn3 UTSW 6 124,433,880 (GRCm39) missense probably damaging 0.99
R9443:Clstn3 UTSW 6 124,428,358 (GRCm39) missense probably damaging 1.00
RF014:Clstn3 UTSW 6 124,436,225 (GRCm39) nonsense probably null
X0066:Clstn3 UTSW 6 124,426,770 (GRCm39) missense probably benign 0.13
Z1176:Clstn3 UTSW 6 124,436,159 (GRCm39) missense probably damaging 1.00
Z1177:Clstn3 UTSW 6 124,426,740 (GRCm39) missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTCCAATGCAACAAAGTCCCTGTC -3'
(R):5'- CCAAAGCTGTGTCTCCACCATTACC -3'

Sequencing Primer
(F):5'- GTCCATCAACCATCTATCTGAGG -3'
(R):5'- TCAGCTTACAACTCTGTTGAGG -3'
Posted On 2014-05-09