Incidental Mutation 'R1655:Klra2'
Institutional Source Beutler Lab
Gene Symbol Klra2
Ensembl Gene ENSMUSG00000030187
Gene Namekiller cell lectin-like receptor, subfamily A, member 2
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R1655 (G1)
Quality Score225
Status Not validated
Chromosomal Location131219223-131247362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 131220211 bp
Amino Acid Change Asparagine to Isoleucine at position 242 (N242I)
Ref Sequence ENSEMBL: ENSMUSP00000032306 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032306] [ENSMUST00000088867]
Predicted Effect probably damaging
Transcript: ENSMUST00000032306
AA Change: N242I

PolyPhen 2 Score 0.957 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000032306
Gene: ENSMUSG00000030187
AA Change: N242I

CLECT 137 260 1.17e-7 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000088867
AA Change: N275I

PolyPhen 2 Score 0.577 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000086252
Gene: ENSMUSG00000030187
AA Change: N275I

CLECT 137 293 6.54e-6 SMART
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: The gene is a member of the large lectin-like type 2 transmembrane receptor family of the natural killer gene complex. The gene is located distantly telomeric to its family's gene cluster on chromosome 6. The gene differs from the other genes in its cluster as its promoter region contains long and short interspersed repetitive elements suggesting a possible rearrangement or gene conversion. It is unknown whether this gene's encoded protein is involved with natural killer cell differentiation as are its other family members. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Klra2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02271:Klra2 APN 6 131230217 missense probably benign 0.11
IGL02280:Klra2 APN 6 131245293 missense probably damaging 1.00
IGL02503:Klra2 APN 6 131230094 missense probably benign 0.10
IGL03120:Klra2 APN 6 131220217 missense probably benign 0.00
FR4449:Klra2 UTSW 6 131221846 frame shift probably null
FR4548:Klra2 UTSW 6 131221851 frame shift probably null
FR4737:Klra2 UTSW 6 131221852 frame shift probably null
R0082:Klra2 UTSW 6 131220247 missense possibly damaging 0.90
R0597:Klra2 UTSW 6 131220185 missense probably benign 0.00
R0606:Klra2 UTSW 6 131220224 missense probably damaging 1.00
R0636:Klra2 UTSW 6 131220104 splice site probably benign
R0800:Klra2 UTSW 6 131230174 nonsense probably null
R1645:Klra2 UTSW 6 131243894 critical splice donor site probably null
R1950:Klra2 UTSW 6 131230115 missense probably benign 0.02
R2088:Klra2 UTSW 6 131242826 missense probably damaging 0.99
R2402:Klra2 UTSW 6 131243901 missense probably benign 0.01
R3776:Klra2 UTSW 6 131242963 missense probably benign 0.06
R4131:Klra2 UTSW 6 131228217 missense probably benign 0.03
R4570:Klra2 UTSW 6 131243937 missense probably damaging 1.00
R4585:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4586:Klra2 UTSW 6 131230157 missense probably benign 0.11
R4884:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R4982:Klra2 UTSW 6 131220189 missense probably benign 0.25
R5043:Klra2 UTSW 6 131220172 missense probably benign 0.06
R5457:Klra2 UTSW 6 131221889 missense possibly damaging 0.92
R6526:Klra2 UTSW 6 131221876 missense probably benign 0.21
R6538:Klra2 UTSW 6 131242990 missense probably damaging 0.99
R7393:Klra2 UTSW 6 131230202 missense probably damaging 1.00
R7785:Klra2 UTSW 6 131245290 missense possibly damaging 0.95
RF020:Klra2 UTSW 6 131221838 frame shift probably null
RF059:Klra2 UTSW 6 131221838 frame shift probably null
RF064:Klra2 UTSW 6 131221839 frame shift probably null
Z1088:Klra2 UTSW 6 131228290 missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- tgtatgggcacatgtcacag -3'
Posted On2014-05-09