Incidental Mutation 'R1655:Mrps35'
Institutional Source Beutler Lab
Gene Symbol Mrps35
Ensembl Gene ENSMUSG00000040112
Gene Namemitochondrial ribosomal protein S35
SynonymsMRPS28, MRP-S28, MDSO23
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.959) question?
Stock #R1655 (G1)
Quality Score222
Status Not validated
Chromosomal Location147042764-147073991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 147060228 bp
Amino Acid Change Aspartic acid to Glutamic Acid at position 200 (D200E)
Ref Sequence ENSEMBL: ENSMUSP00000048348 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036111] [ENSMUST00000137556]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036111
AA Change: D200E

PolyPhen 2 Score 0.837 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000048348
Gene: ENSMUSG00000040112
AA Change: D200E

Pfam:MRP-S28 138 262 2.5e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123139
Predicted Effect probably benign
Transcript: ENSMUST00000137556
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143204
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 28S subunit protein that has had confusing nomenclature in the literature. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. Pseudogenes corresponding to this gene are found on chromosomes 3p, 5q, and 10q. [provided by RefSeq, Jul 2010]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Mrps35
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00912:Mrps35 APN 6 147055921 missense possibly damaging 0.86
IGL01776:Mrps35 APN 6 147070716 missense probably benign 0.33
IGL02134:Mrps35 APN 6 147048310 splice site probably benign
IGL03382:Mrps35 APN 6 147049875 nonsense probably null
R0600:Mrps35 UTSW 6 147070734 missense possibly damaging 0.53
R0648:Mrps35 UTSW 6 147055945 nonsense probably null
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1466:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R1584:Mrps35 UTSW 6 147055984 missense probably damaging 0.98
R2018:Mrps35 UTSW 6 147061484 nonsense probably null
R2257:Mrps35 UTSW 6 147070627 missense possibly damaging 0.85
R4989:Mrps35 UTSW 6 147060147 missense possibly damaging 0.85
R5174:Mrps35 UTSW 6 147060211 missense possibly damaging 0.93
R5453:Mrps35 UTSW 6 147070617 missense probably benign 0.32
R6682:Mrps35 UTSW 6 147048279 missense possibly damaging 0.86
R7181:Mrps35 UTSW 6 147055993 critical splice donor site probably null
R7409:Mrps35 UTSW 6 147055983 missense possibly damaging 0.71
R8132:Mrps35 UTSW 6 147048163 missense probably benign
X0066:Mrps35 UTSW 6 147070720 missense possibly damaging 0.72
Predicted Primers PCR Primer

Sequencing Primer
(R):5'- acacacacacacaaaagcac -3'
Posted On2014-05-09