Mutagenetix > Incidental Mutation

Incidental Mutation 'R1655:Cfap46'

189031

Institutional Source

Beutler Lab

Gene Symbol

Cfap46

Ensembl Gene

ENSMUSG00000049571

Gene Name

cilia and flagella associated protein 46

Synonyms

9330101J02Rik

MMRRC Submission

039691-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R1655 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

139600951-139683817 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 139642520 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Stop codon at position 1180 (Y1180*)

Ref Sequence

ENSEMBL: ENSMUSP00000120186 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000129990] [ENSMUST00000140820] [ENSMUST00000155075]

AlphaFold

E9Q2C0

Predicted Effect

probably null
Transcript: ENSMUST00000129990
AA Change: Y1180*

SMART Domains

Protein: ENSMUSP00000120186
Gene: ENSMUSG00000049571
AA Change: Y1180*

Domain	Start	End	E-Value	Type
Blast:TPR	175	207	7e-11	BLAST
Blast:TPR	426	459	1e-11	BLAST
low complexity region	868	879	N/A	INTRINSIC
Blast:TPR	936	969	2e-7	BLAST
Blast:TPR	1112	1145	1e-9	BLAST
coiled coil region	1347	1423	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000140820

SMART Domains

Protein: ENSMUSP00000121085
Gene: ENSMUSG00000049571

Domain	Start	End	E-Value	Type
Blast:TPR	175	208	5e-11	BLAST
Blast:TPR	426	459	8e-12	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000155075

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156116

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Crtc3	A	T	7: 80,598,776	M313K	possibly damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Disp1	A	T	1: 183,087,004	I1284N	probably benign	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rictor	T	A	15: 6,772,212	D460E	probably benign	Het
Rpn1	T	C	6: 88,100,944	V454A	possibly damaging	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Serpinb3a	A	G	1: 107,046,212	V323A	probably damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Top1	T	A	2: 160,703,696		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Cfap46

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00480:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00493:Cfap46	APN	7	139614443	missense	probably benign	0.06
IGL00505:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00508:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL00514:Cfap46	APN	7	139660689	missense	probably damaging	0.96
IGL01394:Cfap46	APN	7	139666979	missense	probably damaging	1.00
IGL01621:Cfap46	APN	7	139606607	missense	unknown
IGL02171:Cfap46	APN	7	139667056	missense	possibly damaging	0.86
IGL02343:Cfap46	APN	7	139682509	missense	probably damaging	0.99
IGL02679:Cfap46	APN	7	139614470	missense	probably damaging	0.99
IGL02687:Cfap46	APN	7	139607201	missense	probably damaging	0.99
IGL03180:Cfap46	APN	7	139603252	missense	unknown
IGL03329:Cfap46	APN	7	139601165	missense	probably damaging	0.99
FR4449:Cfap46	UTSW	7	139638795	utr 3 prime	probably benign
FR4737:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
FR4976:Cfap46	UTSW	7	139638930	utr 3 prime	probably benign
PIT4651001:Cfap46	UTSW	7	139645551	missense
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0051:Cfap46	UTSW	7	139676035	missense	probably damaging	1.00
R0318:Cfap46	UTSW	7	139654566	missense	probably damaging	1.00
R0358:Cfap46	UTSW	7	139651533	splice site	probably benign
R0650:Cfap46	UTSW	7	139605655	missense	unknown
R0675:Cfap46	UTSW	7	139676034	missense	probably damaging	1.00
R0750:Cfap46	UTSW	7	139654670	missense	probably damaging	1.00
R0931:Cfap46	UTSW	7	139655841	missense	probably damaging	1.00
R1024:Cfap46	UTSW	7	139642597	missense	probably benign	0.42
R1251:Cfap46	UTSW	7	139601265	missense	probably benign	0.40
R1257:Cfap46	UTSW	7	139654629	nonsense	probably null
R1538:Cfap46	UTSW	7	139683008	missense	probably null	1.00
R1618:Cfap46	UTSW	7	139652810	missense	probably benign	0.04
R1824:Cfap46	UTSW	7	139639602	missense	probably benign	0.12
R1830:Cfap46	UTSW	7	139640407	missense	possibly damaging	0.92
R1857:Cfap46	UTSW	7	139653408	missense	probably damaging	1.00
R1870:Cfap46	UTSW	7	139683470	missense	probably damaging	1.00
R1945:Cfap46	UTSW	7	139679903	missense	probably damaging	1.00
R1962:Cfap46	UTSW	7	139667041	missense	probably damaging	1.00
R2108:Cfap46	UTSW	7	139683761	missense	probably benign	0.03
R2354:Cfap46	UTSW	7	139661046	missense	probably damaging	0.99
R2367:Cfap46	UTSW	7	139653498	missense	probably damaging	0.99
R3237:Cfap46	UTSW	7	139617590	missense	probably damaging	1.00
R3617:Cfap46	UTSW	7	139639599	missense	probably benign	0.06
R3949:Cfap46	UTSW	7	139678551	missense	probably benign	0.12
R4239:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4240:Cfap46	UTSW	7	139666287	missense	possibly damaging	0.74
R4297:Cfap46	UTSW	7	139652673	missense	probably benign	0.27
R4365:Cfap46	UTSW	7	139650952	missense	probably damaging	0.99
R4516:Cfap46	UTSW	7	139660082	intron	probably benign
R4595:Cfap46	UTSW	7	139652404	missense	possibly damaging	0.74
R4627:Cfap46	UTSW	7	139657281	missense	probably damaging	0.99
R4627:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4628:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4629:Cfap46	UTSW	7	139680927	missense	probably damaging	1.00
R4687:Cfap46	UTSW	7	139627456	missense	possibly damaging	0.79
R4750:Cfap46	UTSW	7	139679323	critical splice donor site	probably null
R4771:Cfap46	UTSW	7	139630608	missense	probably null
R4779:Cfap46	UTSW	7	139659815	intron	probably benign
R4812:Cfap46	UTSW	7	139636000	missense	probably damaging	1.00
R4974:Cfap46	UTSW	7	139607188	critical splice donor site	probably null
R5014:Cfap46	UTSW	7	139627375	missense	probably benign	0.12
R5033:Cfap46	UTSW	7	139603860	missense	probably benign	0.00
R5055:Cfap46	UTSW	7	139661190	missense	probably damaging	1.00
R5254:Cfap46	UTSW	7	139678514	missense	possibly damaging	0.77
R5288:Cfap46	UTSW	7	139613507	critical splice donor site	probably null
R5366:Cfap46	UTSW	7	139650886	missense	probably damaging	1.00
R5368:Cfap46	UTSW	7	139627473	missense	possibly damaging	0.77
R5371:Cfap46	UTSW	7	139632181	splice site	probably null
R5642:Cfap46	UTSW	7	139678577	missense	probably damaging	1.00
R5690:Cfap46	UTSW	7	139638353	missense	probably benign	0.01
R5691:Cfap46	UTSW	7	139606700	missense	possibly damaging	0.49
R5696:Cfap46	UTSW	7	139612031	missense	probably damaging	1.00
R5844:Cfap46	UTSW	7	139650942	missense	probably damaging	0.99
R5963:Cfap46	UTSW	7	139651595	missense	probably damaging	0.97
R6217:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6228:Cfap46	UTSW	7	139656580	missense	probably damaging	1.00
R6251:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6253:Cfap46	UTSW	7	139638900	utr 3 prime	probably benign
R6285:Cfap46	UTSW	7	139661085	missense	probably damaging	1.00
R6334:Cfap46	UTSW	7	139680831	missense	probably damaging	1.00
R6520:Cfap46	UTSW	7	139614405	critical splice donor site	probably null
R6736:Cfap46	UTSW	7	139619971	missense	possibly damaging	0.92
R6760:Cfap46	UTSW	7	139652440	missense	probably damaging	1.00
R6773:Cfap46	UTSW	7	139642561	utr 3 prime	probably benign
R6835:Cfap46	UTSW	7	139652498	missense	probably damaging	0.98
R6903:Cfap46	UTSW	7	139654561	critical splice donor site	probably null
R6912:Cfap46	UTSW	7	139639700	missense	probably benign	0.09
R7163:Cfap46	UTSW	7	139618078	critical splice donor site	probably null
R7232:Cfap46	UTSW	7	139617577	missense	unknown
R7327:Cfap46	UTSW	7	139635146	splice site	probably null
R7336:Cfap46	UTSW	7	139620104	missense	unknown
R7337:Cfap46	UTSW	7	139630576	critical splice donor site	probably null
R7437:Cfap46	UTSW	7	139650837	nonsense	probably null
R7450:Cfap46	UTSW	7	139617437	missense	unknown
R7495:Cfap46	UTSW	7	139603196	critical splice donor site	probably null
R7618:Cfap46	UTSW	7	139603239	missense
R7623:Cfap46	UTSW	7	139618350	missense	unknown
R7765:Cfap46	UTSW	7	139651564	missense
R7971:Cfap46	UTSW	7	139635127	missense	unknown
R8211:Cfap46	UTSW	7	139633304	missense	unknown
R8306:Cfap46	UTSW	7	139656580	missense
R8354:Cfap46	UTSW	7	139653498	missense	probably benign	0.03
R8365:Cfap46	UTSW	7	139683084	nonsense	probably null
R8447:Cfap46	UTSW	7	139680986	missense	possibly damaging	0.90
R8715:Cfap46	UTSW	7	139605644	missense
R8805:Cfap46	UTSW	7	139632063	missense	unknown
R8830:Cfap46	UTSW	7	139615649	missense	unknown
R8912:Cfap46	UTSW	7	139680181	intron	probably benign
R8920:Cfap46	UTSW	7	139652526	missense
R8977:Cfap46	UTSW	7	139679933	missense	probably benign	0.01
R9048:Cfap46	UTSW	7	139627343	missense	unknown
R9224:Cfap46	UTSW	7	139678500	nonsense	probably null
R9243:Cfap46	UTSW	7	139615349	intron	probably benign
R9252:Cfap46	UTSW	7	139618249	missense	unknown
R9276:Cfap46	UTSW	7	139621291	missense	unknown
R9301:Cfap46	UTSW	7	139642545	missense
R9391:Cfap46	UTSW	7	139618111	missense	unknown
R9402:Cfap46	UTSW	7	139635949	missense	unknown
R9443:Cfap46	UTSW	7	139615107	missense
R9564:Cfap46	UTSW	7	139651555	missense
R9625:Cfap46	UTSW	7	139650889	missense
R9626:Cfap46	UTSW	7	139650889	missense
R9638:Cfap46	UTSW	7	139629847	missense	unknown
R9656:Cfap46	UTSW	7	139655900	missense
R9658:Cfap46	UTSW	7	139666313	missense
R9747:Cfap46	UTSW	7	139611991	missense	unknown
RF023:Cfap46	UTSW	7	139638918
W0251:Cfap46	UTSW	7	139603946	missense	probably benign	0.11
X0018:Cfap46	UTSW	7	139680912	missense	probably benign	0.03
X0064:Cfap46	UTSW	7	139603447	missense	probably benign	0.01
Z1088:Cfap46	UTSW	7	139635064	missense	probably damaging	0.96
Z1176:Cfap46	UTSW	7	139639548	missense
Z1177:Cfap46	UTSW	7	139601267	missense	unknown
Z1177:Cfap46	UTSW	7	139630626	missense	unknown

Predicted Primers

PCR Primer
(F):5'- TCTAGCCTCAACCAGGGCTTACTAC -3'
(R):5'- CCTGCCAACAGGAACATAGGCAATG -3'

Sequencing Primer
(F):5'- AGTGACATCCTCTGAGCTGAC -3'
(R):5'- GGCCATCCTATATGCCACG -3'

Posted On

2014-05-09