Incidental Mutation 'R1655:Csgalnact1'
ID 189033
Institutional Source Beutler Lab
Gene Symbol Csgalnact1
Ensembl Gene ENSMUSG00000036356
Gene Name chondroitin sulfate N-acetylgalactosaminyltransferase 1
Synonyms CSGalNAcT-1, 4732435N03Rik
MMRRC Submission 039691-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.069) question?
Stock # R1655 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 68809433-69187798 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 68826341 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 326 (I326F)
Ref Sequence ENSEMBL: ENSMUSP00000119817 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078350] [ENSMUST00000130214]
AlphaFold Q8BJQ9
Predicted Effect possibly damaging
Transcript: ENSMUST00000078350
AA Change: I326F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000077459
Gene: ENSMUSG00000036356
AA Change: I326F

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 55 505 3.5e-85 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.2e-10 PFAM
Pfam:Glyco_transf_7C 409 478 1.7e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124929
Predicted Effect possibly damaging
Transcript: ENSMUST00000130214
AA Change: I326F

PolyPhen 2 Score 0.893 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119817
Gene: ENSMUSG00000036356
AA Change: I326F

DomainStartEndE-ValueType
transmembrane domain 9 31 N/A INTRINSIC
Pfam:CHGN 71 505 1.1e-59 PFAM
Pfam:Glyco_tranf_2_2 263 478 3.6e-10 PFAM
Pfam:Glyco_transf_7C 405 478 3.4e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139265
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased body weight and length, short limbs, and abnormal cartilage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A730061H03Rik A T 14: 55,797,790 (GRCm39) probably benign Het
Abca1 C T 4: 53,050,964 (GRCm39) A1582T probably benign Het
Acot8 A T 2: 164,645,028 (GRCm39) S52T probably benign Het
Atcay C T 10: 81,049,231 (GRCm39) V124M probably damaging Het
Cep295 C T 9: 15,252,179 (GRCm39) E397K probably damaging Het
Cfap46 A T 7: 139,222,436 (GRCm39) Y1180* probably null Het
Clptm1 T A 7: 19,379,792 (GRCm39) H148L probably benign Het
Clstn3 A G 6: 124,414,386 (GRCm39) L743P probably damaging Het
Crtc3 A T 7: 80,248,524 (GRCm39) M313K possibly damaging Het
Dennd6b G T 15: 89,080,543 (GRCm39) T19K unknown Het
Disp1 A T 1: 182,868,568 (GRCm39) I1284N probably benign Het
Dnah2 A G 11: 69,364,680 (GRCm39) Y1992H probably damaging Het
Dnah6 C T 6: 73,182,715 (GRCm39) V205I possibly damaging Het
Dst G T 1: 34,321,657 (GRCm39) G4391* probably null Het
Dytn A G 1: 63,700,357 (GRCm39) S258P probably damaging Het
Emilin3 T A 2: 160,752,786 (GRCm39) probably null Het
Ermn C T 2: 57,942,596 (GRCm39) V45I probably benign Het
Fat4 T C 3: 39,011,467 (GRCm39) V2189A probably damaging Het
Fcgbpl1 A T 7: 27,846,535 (GRCm39) N1076Y probably damaging Het
Filip1l T C 16: 57,392,214 (GRCm39) I934T probably damaging Het
Gbp9 T A 5: 105,229,558 (GRCm39) Q472L possibly damaging Het
Gimap5 G T 6: 48,730,110 (GRCm39) E227* probably null Het
Gsdmc C T 15: 63,651,892 (GRCm39) V240M probably benign Het
H2-Q4 G T 17: 35,601,881 (GRCm39) V248F probably damaging Het
Helz2 T C 2: 180,875,940 (GRCm39) E1518G probably damaging Het
Hmcn1 A G 1: 150,506,084 (GRCm39) V3814A probably benign Het
Hoatz A T 9: 50,994,921 (GRCm39) I136N probably damaging Het
Ifna7 A G 4: 88,734,897 (GRCm39) T145A probably benign Het
Itgam T A 7: 127,714,335 (GRCm39) M947K probably benign Het
Itpr2 T G 6: 146,277,646 (GRCm39) N608H probably damaging Het
Klra2 T A 6: 131,197,174 (GRCm39) N242I probably damaging Het
Lonrf2 A T 1: 38,850,905 (GRCm39) L219Q probably damaging Het
Ly6c2 T C 15: 74,980,412 (GRCm39) I126V probably benign Het
Mr1 G A 1: 155,008,201 (GRCm39) T258M probably benign Het
Mrps35 T G 6: 146,961,726 (GRCm39) D200E possibly damaging Het
Nbeal2 A C 9: 110,461,940 (GRCm39) S1506A probably damaging Het
Ncoa7 T C 10: 30,574,241 (GRCm39) probably null Het
Nlrp4a A T 7: 26,149,076 (GRCm39) I228F possibly damaging Het
Or13p5 A G 4: 118,592,196 (GRCm39) S157G probably benign Het
Or5c1 A G 2: 37,221,951 (GRCm39) Y64C probably damaging Het
Or5p59 A T 7: 107,702,671 (GRCm39) I52F probably damaging Het
Or8k3 A G 2: 86,058,424 (GRCm39) V297A possibly damaging Het
Paxx T C 2: 25,350,328 (GRCm39) E93G probably damaging Het
Per2 C A 1: 91,376,490 (GRCm39) G128W probably damaging Het
Piezo1 A G 8: 123,223,561 (GRCm39) I796T probably benign Het
Pkhd1 A G 1: 20,654,353 (GRCm39) S235P probably damaging Het
Pole T A 5: 110,483,788 (GRCm39) F259Y probably damaging Het
Pus7 T A 5: 23,952,798 (GRCm39) K512* probably null Het
Ralyl A T 3: 14,172,296 (GRCm39) Y55F probably damaging Het
Rgs14 T A 13: 55,531,347 (GRCm39) M451K probably benign Het
Rhag T C 17: 41,142,487 (GRCm39) F231L probably damaging Het
Ric8a T C 7: 140,440,808 (GRCm39) C94R probably benign Het
Rictor T A 15: 6,801,693 (GRCm39) D460E probably benign Het
Rpn1 T C 6: 88,077,926 (GRCm39) V454A possibly damaging Het
Sacs A G 14: 61,429,231 (GRCm39) D427G probably benign Het
Scai A T 2: 38,970,129 (GRCm39) V545D possibly damaging Het
Serpinb3a A G 1: 106,973,942 (GRCm39) V323A probably damaging Het
Slc13a5 C A 11: 72,148,204 (GRCm39) C277F probably benign Het
Slc15a1 A T 14: 121,703,311 (GRCm39) Y557N probably benign Het
Slc34a2 T C 5: 53,226,761 (GRCm39) V628A probably benign Het
Slc8a2 G T 7: 15,875,060 (GRCm39) G436V probably damaging Het
Sphkap G A 1: 83,255,236 (GRCm39) R838* probably null Het
Supt5 T C 7: 28,029,449 (GRCm39) I103V probably benign Het
Tdrd1 T A 19: 56,831,648 (GRCm39) Y346* probably null Het
Tg T G 15: 66,700,417 (GRCm39) probably null Het
Top1 T A 2: 160,545,616 (GRCm39) probably null Het
Trmt12 T C 15: 58,745,076 (GRCm39) L158P probably damaging Het
Tssk4 A G 14: 55,889,152 (GRCm39) N226S probably damaging Het
Unc80 G T 1: 66,711,915 (GRCm39) V2746F possibly damaging Het
Usp34 T A 11: 23,325,051 (GRCm39) V999E probably benign Het
Virma T C 4: 11,494,786 (GRCm39) V29A probably damaging Het
Zfp40 A T 17: 23,396,240 (GRCm39) Y48N probably benign Het
Zfp609 A G 9: 65,610,836 (GRCm39) V709A possibly damaging Het
Other mutations in Csgalnact1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02015:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02025:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02037:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02059:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02074:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02079:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02080:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02094:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02127:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02128:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02157:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02158:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02197:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02201:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02206:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02207:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02214:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02215:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02229:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02243:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02247:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02248:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02250:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02389:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02394:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02397:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02398:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02400:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02404:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02405:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02406:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02420:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02425:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02428:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02436:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02437:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02438:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02468:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02470:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02472:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02473:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02474:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02475:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02510:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02529:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02530:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02531:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02533:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02543:Csgalnact1 APN 8 68,913,720 (GRCm39) missense probably damaging 1.00
IGL02620:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02625:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02671:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02674:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02683:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02685:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02686:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02697:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02698:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02741:Csgalnact1 APN 8 68,854,144 (GRCm39) missense probably damaging 1.00
IGL02985:Csgalnact1 APN 8 68,913,695 (GRCm39) missense probably benign 0.02
R0173:Csgalnact1 UTSW 8 68,913,681 (GRCm39) missense probably damaging 1.00
R1594:Csgalnact1 UTSW 8 68,811,284 (GRCm39) missense probably damaging 1.00
R1873:Csgalnact1 UTSW 8 68,854,036 (GRCm39) missense probably benign 0.02
R1955:Csgalnact1 UTSW 8 68,825,319 (GRCm39) missense probably benign
R2421:Csgalnact1 UTSW 8 68,914,160 (GRCm39) missense probably benign 0.42
R3195:Csgalnact1 UTSW 8 68,913,737 (GRCm39) frame shift probably null
R3196:Csgalnact1 UTSW 8 68,913,737 (GRCm39) frame shift probably null
R3951:Csgalnact1 UTSW 8 68,913,914 (GRCm39) missense probably benign
R4304:Csgalnact1 UTSW 8 68,825,294 (GRCm39) missense possibly damaging 0.94
R4989:Csgalnact1 UTSW 8 68,913,623 (GRCm39) missense probably benign 0.01
R5133:Csgalnact1 UTSW 8 68,913,623 (GRCm39) missense probably benign 0.01
R5134:Csgalnact1 UTSW 8 68,913,623 (GRCm39) missense probably benign 0.01
R5503:Csgalnact1 UTSW 8 68,914,125 (GRCm39) missense probably damaging 0.98
R5812:Csgalnact1 UTSW 8 68,854,036 (GRCm39) missense probably benign 0.02
R6143:Csgalnact1 UTSW 8 68,826,202 (GRCm39) missense probably damaging 1.00
R6387:Csgalnact1 UTSW 8 68,811,365 (GRCm39) missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68,913,762 (GRCm39) missense probably damaging 1.00
R6476:Csgalnact1 UTSW 8 68,913,761 (GRCm39) missense probably damaging 1.00
R7023:Csgalnact1 UTSW 8 68,811,081 (GRCm39) missense probably benign
R8318:Csgalnact1 UTSW 8 68,913,785 (GRCm39) missense probably damaging 1.00
R8446:Csgalnact1 UTSW 8 68,913,743 (GRCm39) missense probably damaging 0.99
R8519:Csgalnact1 UTSW 8 68,854,105 (GRCm39) missense possibly damaging 0.65
R8674:Csgalnact1 UTSW 8 68,826,268 (GRCm39) missense possibly damaging 0.91
R8782:Csgalnact1 UTSW 8 68,811,307 (GRCm39) missense probably damaging 1.00
R9210:Csgalnact1 UTSW 8 68,914,241 (GRCm39) start gained probably benign
R9619:Csgalnact1 UTSW 8 68,854,006 (GRCm39) missense probably damaging 0.99
Z1088:Csgalnact1 UTSW 8 68,853,982 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAAAGTGACTCTCAGTCCTGAGC -3'
(R):5'- ACCCTGGTGGTGTCTATTCAGTCTG -3'

Sequencing Primer
(F):5'- ACATCAGAGTGGACTGTACAC -3'
(R):5'- GGTGTCTATTCAGTCTGGCTACTC -3'
Posted On 2014-05-09