Mutagenetix > Incidental Mutations

Incidental Mutation 'R1655:Cep295'

189035

Institutional Source

Beutler Lab

Gene Symbol

Cep295

Ensembl Gene

ENSMUSG00000046111

Gene Name

centrosomal protein 295

Synonyms

LOC382128, 5830418K08Rik

MMRRC Submission

039691-MU

Accession Numbers

Is this an essential gene?

Probably essential (E-score: 0.946) question?

Stock #

R1655 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

15316915-15357788 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 15340883 bp

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Lysine at position 397 (E397K)

Ref Sequence

ENSEMBL: ENSMUSP00000096578 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000098979] [ENSMUST00000161132]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000059410

Predicted Effect

probably damaging
Transcript: ENSMUST00000098979
AA Change: E397K

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000096578
Gene: ENSMUSG00000046111
AA Change: E397K

Domain	Start	End	E-Value	Type
low complexity region	159	175	N/A	INTRINSIC
coiled coil region	258	288	N/A	INTRINSIC
coiled coil region	536	583	N/A	INTRINSIC
coiled coil region	861	889	N/A	INTRINSIC
internal_repeat_1	890	1104	6.8e-5	PROSPERO
internal_repeat_1	1277	1489	6.8e-5	PROSPERO
low complexity region	1537	1548	N/A	INTRINSIC
low complexity region	1611	1625	N/A	INTRINSIC
coiled coil region	1707	1736	N/A	INTRINSIC
low complexity region	2003	2018	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161132
AA Change: E397K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000123788
Gene: ENSMUSG00000046111
AA Change: E397K

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
coiled coil region	1300	1327	N/A	INTRINSIC
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	2035	2050	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000161795
AA Change: E349K

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000125035
Gene: ENSMUSG00000046111
AA Change: E349K

Domain	Start	End	E-Value	Type
low complexity region	111	127	N/A	INTRINSIC
coiled coil region	210	240	N/A	INTRINSIC
coiled coil region	488	535	N/A	INTRINSIC
coiled coil region	813	841	N/A	INTRINSIC
internal_repeat_1	842	1056	7.14e-5	PROSPERO
internal_repeat_1	1229	1441	7.14e-5	PROSPERO
low complexity region	1489	1500	N/A	INTRINSIC
low complexity region	1563	1577	N/A	INTRINSIC
coiled coil region	1659	1688	N/A	INTRINSIC
low complexity region	1955	1970	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000162689

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000163010

Meta Mutation Damage Score

0.1905

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cfap46	A	T	7: 139,642,520	Y1180*	probably null	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Crtc3	A	T	7: 80,598,776	M313K	possibly damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Disp1	A	T	1: 183,087,004	I1284N	probably benign	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rictor	T	A	15: 6,772,212	D460E	probably benign	Het
Rpn1	T	C	6: 88,100,944	V454A	possibly damaging	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Serpinb3a	A	G	1: 107,046,212	V323A	probably damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Top1	T	A	2: 160,703,696		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Cep295

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00337:Cep295	APN	9	15326072	splice site	probably null
IGL00769:Cep295	APN	9	15326144	missense	probably damaging	1.00
IGL00771:Cep295	APN	9	15322565	missense	probably damaging	1.00
IGL00850:Cep295	APN	9	15322852	missense	probably benign	0.36
IGL01505:Cep295	APN	9	15318049	missense	probably benign	0.08
IGL01510:Cep295	APN	9	15354626	nonsense	probably null
IGL01759:Cep295	APN	9	15323559	splice site	probably null
IGL02415:Cep295	APN	9	15353020	missense	probably damaging	1.00
IGL02447:Cep295	APN	9	15332511	missense	probably damaging	0.98
IGL02502:Cep295	APN	9	15350913	splice site	probably benign
IGL02665:Cep295	APN	9	15326632	splice site	probably benign
IGL02718:Cep295	APN	9	15325753	splice site	probably null
IGL02995:Cep295	APN	9	15333312	missense	probably damaging	1.00
IGL03024:Cep295	APN	9	15325572	missense	probably benign
R0196:Cep295	UTSW	9	15338213	missense	probably damaging	0.96
R0398:Cep295	UTSW	9	15354736	missense	possibly damaging	0.90
R0595:Cep295	UTSW	9	15332191	nonsense	probably null
R0610:Cep295	UTSW	9	15322754	missense	possibly damaging	0.81
R0616:Cep295	UTSW	9	15332322	nonsense	probably null
R0840:Cep295	UTSW	9	15334315	missense	probably benign	0.02
R1215:Cep295	UTSW	9	15327882	missense	probably benign	0.00
R1376:Cep295	UTSW	9	15340868	splice site	probably benign
R1381:Cep295	UTSW	9	15322565	missense	probably benign	0.02
R1484:Cep295	UTSW	9	15334784	missense	probably damaging	0.99
R1557:Cep295	UTSW	9	15332010	nonsense	probably null
R1682:Cep295	UTSW	9	15333921	missense	probably benign	0.02
R1700:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1734:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1736:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1743:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1765:Cep295	UTSW	9	15327904	missense	probably damaging	1.00
R1889:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1895:Cep295	UTSW	9	15332103	missense	possibly damaging	0.94
R1994:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R1995:Cep295	UTSW	9	15340883	missense	probably damaging	0.99
R2071:Cep295	UTSW	9	15341564	missense	probably damaging	1.00
R2161:Cep295	UTSW	9	15353058	missense	probably damaging	0.99
R2195:Cep295	UTSW	9	15332321	missense	probably damaging	0.99
R2354:Cep295	UTSW	9	15334784	missense	possibly damaging	0.92
R2427:Cep295	UTSW	9	15334238	missense	probably damaging	1.00
R2992:Cep295	UTSW	9	15332747	missense	probably damaging	1.00
R3873:Cep295	UTSW	9	15333365	missense	probably damaging	1.00
R3981:Cep295	UTSW	9	15317067	utr 3 prime	probably benign
R4201:Cep295	UTSW	9	15332538	missense	probably benign	0.19
R4297:Cep295	UTSW	9	15322654	missense	probably benign	0.19
R4543:Cep295	UTSW	9	15335253	missense	possibly damaging	0.94
R4584:Cep295	UTSW	9	15334799	missense	possibly damaging	0.96
R4724:Cep295	UTSW	9	15330832	missense	probably damaging	1.00
R4878:Cep295	UTSW	9	15334956	missense	probably benign	0.11
R4884:Cep295	UTSW	9	15351760	missense	probably damaging	1.00
R4934:Cep295	UTSW	9	15333160	missense	probably damaging	0.97
R4990:Cep295	UTSW	9	15332138	missense	probably damaging	1.00
R5057:Cep295	UTSW	9	15322683	missense	probably benign	0.00
R5153:Cep295	UTSW	9	15357629	missense	probably benign	0.32
R5180:Cep295	UTSW	9	15332120	missense	probably benign
R5285:Cep295	UTSW	9	15322591	missense	probably benign	0.14
R5360:Cep295	UTSW	9	15326733	missense	probably damaging	1.00
R5419:Cep295	UTSW	9	15324237	missense	probably damaging	0.98
R5432:Cep295	UTSW	9	15351695	missense	possibly damaging	0.95
R5625:Cep295	UTSW	9	15340891	missense	probably damaging	0.99
R5637:Cep295	UTSW	9	15333812	splice site	probably null
R5645:Cep295	UTSW	9	15332794	missense	probably damaging	0.98
R5645:Cep295	UTSW	9	15335108	missense	possibly damaging	0.89
R5678:Cep295	UTSW	9	15322858	missense	probably damaging	0.99
R5688:Cep295	UTSW	9	15331986	missense	probably damaging	1.00
R5807:Cep295	UTSW	9	15332532	missense	probably damaging	1.00
R5824:Cep295	UTSW	9	15325656	missense	possibly damaging	0.90
R5837:Cep295	UTSW	9	15346984	missense	probably damaging	0.99
R5915:Cep295	UTSW	9	15341479	missense	probably damaging	1.00
R5988:Cep295	UTSW	9	15341474	missense	probably damaging	1.00
R6239:Cep295	UTSW	9	15322631	missense	possibly damaging	0.46
R6332:Cep295	UTSW	9	15334914	missense	possibly damaging	0.90
R6383:Cep295	UTSW	9	15332754	missense	probably damaging	0.99
R6737:Cep295	UTSW	9	15332351	missense	possibly damaging	0.90
R6929:Cep295	UTSW	9	15333062	missense	probably damaging	1.00
R7428:Cep295	UTSW	9	15333498	missense	possibly damaging	0.61
R7697:Cep295	UTSW	9	15354710	missense	probably benign	0.01
R7963:Cep295	UTSW	9	15333441	missense	possibly damaging	0.90
R8055:Cep295	UTSW	9	15333609	missense	probably benign	0.00
R8069:Cep295	UTSW	9	15322586	missense	possibly damaging	0.94
R8092:Cep295	UTSW	9	15332982	missense	probably benign	0.17
R8117:Cep295	UTSW	9	15334364	missense	probably damaging	0.99
R8140:Cep295	UTSW	9	15341533	missense	probably benign	0.00
R8178:Cep295	UTSW	9	15333540	missense
R8323:Cep295	UTSW	9	15338233	missense	possibly damaging	0.53
R8323:Cep295	UTSW	9	15353061	missense	probably damaging	0.96
R8339:Cep295	UTSW	9	15325550	missense
R8351:Cep295	UTSW	9	15322906	missense	probably damaging	0.99
R8367:Cep295	UTSW	9	15334530	missense	probably benign	0.09
X0065:Cep295	UTSW	9	15322891	missense	probably benign	0.36
Z1176:Cep295	UTSW	9	15357697	missense	probably damaging	0.99
Z1177:Cep295	UTSW	9	15330817	missense

Predicted Primers

PCR Primer
(F):5'- TCTCCAATGGCAGAAACAGACATGC -3'
(R):5'- AGGGACTGTCACCAGTGCTTTTAAATG -3'

Sequencing Primer
(F):5'- CAGACATGCAGAGTAGCAATGC -3'
(R):5'- agccatctcaccagccc -3'

Posted On

2014-05-09