Incidental Mutation 'R1655:Rgs14'
ID 189047
Institutional Source Beutler Lab
Gene Symbol Rgs14
Ensembl Gene ENSMUSG00000052087
Gene Name regulator of G-protein signaling 14
Synonyms Rap1/rap2 interacting protein
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.095) question?
Stock # R1655 (G1)
Quality Score 225
Status Not validated
Chromosome 13
Chromosomal Location 55369732-55384687 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 55383534 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 451 (M451K)
Ref Sequence ENSEMBL: ENSMUSP00000068731 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063771] [ENSMUST00000149858]
AlphaFold P97492
PDB Structure Solution structure of the Ras-binding domain of mouse RGS14 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000063771
AA Change: M451K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000068731
Gene: ENSMUSG00000052087
AA Change: M451K

DomainStartEndE-ValueType
RGS 67 184 3.42e-44 SMART
low complexity region 209 222 N/A INTRINSIC
low complexity region 289 299 N/A INTRINSIC
RBD 303 374 2e-26 SMART
RBD 376 446 4.53e-16 SMART
low complexity region 474 491 N/A INTRINSIC
GoLoco 500 522 1.74e-5 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135851
Predicted Effect probably benign
Transcript: ENSMUST00000149858
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224185
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the regulator of G-protein signaling family. This protein contains one RGS domain, two Raf-like Ras-binding domains (RBDs), and one GoLoco domain. The protein attenuates the signaling activity of G-proteins by binding, through its GoLoco domain, to specific types of activated, GTP-bound G alpha subunits. Acting as a GTPase activating protein (GAP), the protein increases the rate of conversion of the GTP to GDP. This hydrolysis allows the G alpha subunits to bind G beta/gamma subunit heterodimers, forming inactive G-protein heterotrimers, thereby terminating the signal. Alternate transcriptional splice variants of this gene have been observed but have not been thoroughly characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutation of this gene with one allele results in failure to complete the first zygotic cell division. Homozygous mutation of this gene with a second allele results in no obvious phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Rgs14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01820:Rgs14 APN 13 55383525 missense probably benign 0.04
IGL02691:Rgs14 APN 13 55379023 splice site probably null
R1716:Rgs14 UTSW 13 55378883 missense probably damaging 0.99
R1839:Rgs14 UTSW 13 55382838 unclassified probably benign
R2014:Rgs14 UTSW 13 55383700 nonsense probably null
R3851:Rgs14 UTSW 13 55379614 missense possibly damaging 0.77
R4008:Rgs14 UTSW 13 55369913 missense probably damaging 0.99
R4299:Rgs14 UTSW 13 55383753 missense probably damaging 1.00
R4572:Rgs14 UTSW 13 55380062 missense probably damaging 0.96
R4801:Rgs14 UTSW 13 55380957 missense probably damaging 1.00
R4802:Rgs14 UTSW 13 55380957 missense probably damaging 1.00
R7136:Rgs14 UTSW 13 55379695 splice site probably null
R7142:Rgs14 UTSW 13 55379604 missense probably damaging 0.99
R7207:Rgs14 UTSW 13 55383234 missense probably benign 0.00
R7701:Rgs14 UTSW 13 55379325 missense probably damaging 1.00
R8021:Rgs14 UTSW 13 55383756 missense probably damaging 0.97
R8405:Rgs14 UTSW 13 55383149 missense probably damaging 1.00
R8985:Rgs14 UTSW 13 55383421 unclassified probably benign
R9120:Rgs14 UTSW 13 55380979 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGTCAAGCCCTCAAGCTGATAAC -3'
(R):5'- CTACCAGCAAACTGGAGGACGATG -3'

Sequencing Primer
(F):5'- GCTGATAACATCTTTCTGTAGCCAG -3'
(R):5'- GGGGGAAGGTGACTGTCC -3'
Posted On 2014-05-09