Mutagenetix > Incidental Mutations

Incidental Mutation 'R1655:Rictor'

189053

Institutional Source

Beutler Lab

Gene Symbol

Rictor

Ensembl Gene

ENSMUSG00000050310

Gene Name

RPTOR independent companion of MTOR, complex 2

Synonyms

D530039E11Rik, 4921505C17Rik, 6030405M08Rik

MMRRC Submission

039691-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R1655 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

6708379-6800401 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 6772212 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 460 (D460E)

Ref Sequence

ENSEMBL: ENSMUSP00000051809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000061656]

Predicted Effect

probably benign
Transcript: ENSMUST00000061656
AA Change: D460E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: D460E

Domain	Start	End	E-Value	Type
RICTOR_N	57	439	4.02e-185	SMART
RICTOR_M	523	742	5.66e-98	SMART
RasGEF_N_2	743	857	1.26e-54	SMART
RICTOR_V	920	992	1.44e-40	SMART
low complexity region	1019	1043	N/A	INTRINSIC
RICTOR_phospho	1084	1189	4.06e-58	SMART
low complexity region	1221	1239	N/A	INTRINSIC
low complexity region	1255	1266	N/A	INTRINSIC
low complexity region	1273	1287	N/A	INTRINSIC
low complexity region	1404	1414	N/A	INTRINSIC
low complexity region	1464	1474	N/A	INTRINSIC
low complexity region	1616	1628	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000228266

Coding Region Coverage

1x: 99.1%
3x: 98.3%
10x: 96.0%
20x: 91.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 73 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4833427G06Rik	A	T	9: 51,083,621	I136N	probably damaging	Het
9530053A07Rik	A	T	7: 28,147,110	N1076Y	probably damaging	Het
A730061H03Rik	A	T	14: 55,560,333		probably benign	Het
Abca1	C	T	4: 53,050,964	A1582T	probably benign	Het
Acot8	A	T	2: 164,803,108	S52T	probably benign	Het
Atcay	C	T	10: 81,213,397	V124M	probably damaging	Het
Cep295	C	T	9: 15,340,883	E397K	probably damaging	Het
Cfap46	A	T	7: 139,642,520	Y1180*	probably null	Het
Clptm1	T	A	7: 19,645,867	H148L	probably benign	Het
Clstn3	A	G	6: 124,437,427	L743P	probably damaging	Het
Crtc3	A	T	7: 80,598,776	M313K	possibly damaging	Het
Csgalnact1	T	A	8: 68,373,689	I326F	possibly damaging	Het
Dennd6b	G	T	15: 89,196,340	T19K	unknown	Het
Disp1	A	T	1: 183,087,004	I1284N	probably benign	Het
Dnah2	A	G	11: 69,473,854	Y1992H	probably damaging	Het
Dnah6	C	T	6: 73,205,732	V205I	possibly damaging	Het
Dst	G	T	1: 34,282,576	G4391*	probably null	Het
Dytn	A	G	1: 63,661,198	S258P	probably damaging	Het
Emilin3	T	A	2: 160,910,866		probably null	Het
Ermn	C	T	2: 58,052,584	V45I	probably benign	Het
Fat4	T	C	3: 38,957,318	V2189A	probably damaging	Het
Filip1l	T	C	16: 57,571,851	I934T	probably damaging	Het
Gbp9	T	A	5: 105,081,692	Q472L	possibly damaging	Het
Gimap5	G	T	6: 48,753,176	E227*	probably null	Het
Gsdmc	C	T	15: 63,780,043	V240M	probably benign	Het
H2-Q4	G	T	17: 35,382,905	V248F	probably damaging	Het
Helz2	T	C	2: 181,234,147	E1518G	probably damaging	Het
Hmcn1	A	G	1: 150,630,333	V3814A	probably benign	Het
Ifna7	A	G	4: 88,816,660	T145A	probably benign	Het
Itgam	T	A	7: 128,115,163	M947K	probably benign	Het
Itpr2	T	G	6: 146,376,148	N608H	probably damaging	Het
Klra2	T	A	6: 131,220,211	N242I	probably damaging	Het
Lonrf2	A	T	1: 38,811,824	L219Q	probably damaging	Het
Ly6c2	T	C	15: 75,108,563	I126V	probably benign	Het
Mr1	G	A	1: 155,132,455	T258M	probably benign	Het
Mrps35	T	G	6: 147,060,228	D200E	possibly damaging	Het
Nbeal2	A	C	9: 110,632,872	S1506A	probably damaging	Het
Ncoa7	T	C	10: 30,698,245		probably null	Het
Nlrp4a	A	T	7: 26,449,651	I228F	possibly damaging	Het
Olfr1047	A	G	2: 86,228,080	V297A	possibly damaging	Het
Olfr1339	A	G	4: 118,734,999	S157G	probably benign	Het
Olfr368	A	G	2: 37,331,939	Y64C	probably damaging	Het
Olfr483	A	T	7: 108,103,464	I52F	probably damaging	Het
Paxx	T	C	2: 25,460,316	E93G	probably damaging	Het
Per2	C	A	1: 91,448,768	G128W	probably damaging	Het
Piezo1	A	G	8: 122,496,822	I796T	probably benign	Het
Pkhd1	A	G	1: 20,584,129	S235P	probably damaging	Het
Pole	T	A	5: 110,335,922	F259Y	probably damaging	Het
Pus7	T	A	5: 23,747,800	K512*	probably null	Het
Ralyl	A	T	3: 14,107,236	Y55F	probably damaging	Het
Rgs14	T	A	13: 55,383,534	M451K	probably benign	Het
Rhag	T	C	17: 40,831,596	F231L	probably damaging	Het
Ric8a	T	C	7: 140,860,895	C94R	probably benign	Het
Rpn1	T	C	6: 88,100,944	V454A	possibly damaging	Het
Sacs	A	G	14: 61,191,782	D427G	probably benign	Het
Scai	A	T	2: 39,080,117	V545D	possibly damaging	Het
Serpinb3a	A	G	1: 107,046,212	V323A	probably damaging	Het
Slc13a5	C	A	11: 72,257,378	C277F	probably benign	Het
Slc15a1	A	T	14: 121,465,899	Y557N	probably benign	Het
Slc34a2	T	C	5: 53,069,419	V628A	probably benign	Het
Slc8a2	G	T	7: 16,141,135	G436V	probably damaging	Het
Sphkap	G	A	1: 83,277,515	R838*	probably null	Het
Supt5	T	C	7: 28,330,024	I103V	probably benign	Het
Tdrd1	T	A	19: 56,843,216	Y346*	probably null	Het
Tg	T	G	15: 66,828,568		probably null	Het
Top1	T	A	2: 160,703,696		probably null	Het
Trmt12	T	C	15: 58,873,227	L158P	probably damaging	Het
Tssk4	A	G	14: 55,651,695	N226S	probably damaging	Het
Unc80	G	T	1: 66,672,756	V2746F	possibly damaging	Het
Usp34	T	A	11: 23,375,051	V999E	probably benign	Het
Virma	T	C	4: 11,494,786	V29A	probably damaging	Het
Zfp40	A	T	17: 23,177,266	Y48N	probably benign	Het
Zfp609	A	G	9: 65,703,554	V709A	possibly damaging	Het

Other mutations in Rictor

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00488:Rictor	APN	15	6786590	missense	probably damaging	0.99
IGL00785:Rictor	APN	15	6776950	missense	probably damaging	1.00
IGL00801:Rictor	APN	15	6794534	missense	probably damaging	1.00
IGL01072:Rictor	APN	15	6789562	missense	probably damaging	0.98
IGL01139:Rictor	APN	15	6778268	missense	probably damaging	1.00
IGL01303:Rictor	APN	15	6708638	missense	probably benign	0.10
IGL01307:Rictor	APN	15	6774604	splice site	probably null
IGL01767:Rictor	APN	15	6777384	missense	probably damaging	1.00
IGL01774:Rictor	APN	15	6769777	missense	probably damaging	1.00
IGL01800:Rictor	APN	15	6774701	missense	probably damaging	0.99
IGL02192:Rictor	APN	15	6786414	missense	probably benign	0.00
IGL02503:Rictor	APN	15	6786443	missense	probably benign	0.06
IGL02652:Rictor	APN	15	6776187	critical splice donor site	probably null
IGL02656:Rictor	APN	15	6776920	missense	probably damaging	0.98
IGL02752:Rictor	APN	15	6787371	missense	probably benign	0.02
IGL03000:Rictor	APN	15	6769240	splice site	probably benign
IGL03118:Rictor	APN	15	6759518	missense	possibly damaging	0.93
IGL03182:Rictor	APN	15	6789598	missense	probably benign	0.08
R0149:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0288:Rictor	UTSW	15	6786540	missense	probably benign	0.08
R0304:Rictor	UTSW	15	6786371	splice site	probably null
R0336:Rictor	UTSW	15	6776753	critical splice acceptor site	probably null
R0361:Rictor	UTSW	15	6784107	missense	possibly damaging	0.76
R0423:Rictor	UTSW	15	6773900	missense	possibly damaging	0.77
R0453:Rictor	UTSW	15	6708642	missense	probably benign	0.01
R0515:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R0630:Rictor	UTSW	15	6794492	missense	probably damaging	1.00
R0730:Rictor	UTSW	15	6773986	splice site	probably benign
R0744:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0836:Rictor	UTSW	15	6764278	critical splice acceptor site	probably null
R0881:Rictor	UTSW	15	6791670	missense	probably benign
R1114:Rictor	UTSW	15	6794005	nonsense	probably null
R1367:Rictor	UTSW	15	6790638	splice site	probably benign
R1678:Rictor	UTSW	15	6756471	missense	probably benign	0.07
R1679:Rictor	UTSW	15	6768090	missense	possibly damaging	0.92
R1754:Rictor	UTSW	15	6735368	missense	probably damaging	1.00
R1757:Rictor	UTSW	15	6773862	missense	possibly damaging	0.95
R1762:Rictor	UTSW	15	6756573	missense	probably benign	0.00
R1914:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1915:Rictor	UTSW	15	6759572	missense	probably damaging	1.00
R1994:Rictor	UTSW	15	6776156	missense	probably benign	0.18
R2145:Rictor	UTSW	15	6765107	missense	probably damaging	1.00
R2182:Rictor	UTSW	15	6772204	missense	probably damaging	0.96
R2191:Rictor	UTSW	15	6759614	missense	probably benign	0.04
R2357:Rictor	UTSW	15	6783562	missense	probably damaging	0.99
R2914:Rictor	UTSW	15	6769995	critical splice donor site	probably null
R3082:Rictor	UTSW	15	6774857	missense	probably benign	0.15
R3885:Rictor	UTSW	15	6759610	missense	probably damaging	1.00
R3900:Rictor	UTSW	15	6789473	missense	probably benign	0.01
R4376:Rictor	UTSW	15	6786967	missense	probably benign	0.00
R4611:Rictor	UTSW	15	6787144	missense	possibly damaging	0.75
R4644:Rictor	UTSW	15	6777935	nonsense	probably null
R4718:Rictor	UTSW	15	6783160	missense	possibly damaging	0.81
R4822:Rictor	UTSW	15	6791680	missense	probably benign	0.01
R4980:Rictor	UTSW	15	6781660	missense	probably damaging	1.00
R5034:Rictor	UTSW	15	6768095	missense	probably damaging	0.98
R5179:Rictor	UTSW	15	6795940	missense	probably damaging	1.00
R5386:Rictor	UTSW	15	6789504	missense	probably benign	0.37
R5532:Rictor	UTSW	15	6789565	missense	probably damaging	1.00
R5549:Rictor	UTSW	15	6786910	missense	probably damaging	1.00
R5715:Rictor	UTSW	15	6750716	nonsense	probably null
R5733:Rictor	UTSW	15	6783104	missense	probably benign
R5822:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5848:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5849:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5850:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5854:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5855:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5856:Rictor	UTSW	15	6794006	missense	probably benign	0.00
R5936:Rictor	UTSW	15	6784161	missense	probably damaging	0.99
R6155:Rictor	UTSW	15	6793977	missense	probably benign	0.44
R6394:Rictor	UTSW	15	6769309	missense	possibly damaging	0.59
R6549:Rictor	UTSW	15	6796175	missense	probably damaging	1.00
R6611:Rictor	UTSW	15	6750659	missense	probably damaging	1.00
R6657:Rictor	UTSW	15	6759496	missense	possibly damaging	0.94
R6705:Rictor	UTSW	15	6794012	missense	probably benign	0.00
R6819:Rictor	UTSW	15	6796036	critical splice donor site	probably null
R6985:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R6989:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7016:Rictor	UTSW	15	6774880	critical splice donor site	probably null
R7030:Rictor	UTSW	15	6708453	critical splice donor site	probably null
R7066:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7067:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7216:Rictor	UTSW	15	6769301	missense	probably damaging	1.00
R7396:Rictor	UTSW	15	6786981	missense	not run
R7449:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7450:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7452:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7616:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7620:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7643:Rictor	UTSW	15	6769269	nonsense	probably null
R7699:Rictor	UTSW	15	6772154	missense	probably benign	0.27
R7700:Rictor	UTSW	15	6772154	missense	probably benign	0.27
X0020:Rictor	UTSW	15	6756482	missense	probably benign	0.32
X0060:Rictor	UTSW	15	6786552	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- CCTTGGGTTTTATTGGTCCTGCATACT -3'
(R):5'- TCTCTAGGCTACTTACTGGAAAAGCGAA -3'

Sequencing Primer
(F):5'- GCATACTGTATTTGTCTCTGAAGTC -3'
(R):5'- AGTTAGGCCCATCTGTAAGC -3'

Posted On

2014-05-09