Incidental Mutation 'R1655:Rictor'
ID 189053
Institutional Source Beutler Lab
Gene Symbol Rictor
Ensembl Gene ENSMUSG00000050310
Gene Name RPTOR independent companion of MTOR, complex 2
Synonyms D530039E11Rik, 4921505C17Rik, 6030405M08Rik
MMRRC Submission 039691-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R1655 (G1)
Quality Score 225
Status Not validated
Chromosome 15
Chromosomal Location 6708379-6800401 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 6772212 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 460 (D460E)
Ref Sequence ENSEMBL: ENSMUSP00000051809 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061656]
AlphaFold Q6QI06
Predicted Effect probably benign
Transcript: ENSMUST00000061656
AA Change: D460E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000051809
Gene: ENSMUSG00000050310
AA Change: D460E

DomainStartEndE-ValueType
RICTOR_N 57 439 4.02e-185 SMART
RICTOR_M 523 742 5.66e-98 SMART
RasGEF_N_2 743 857 1.26e-54 SMART
RICTOR_V 920 992 1.44e-40 SMART
low complexity region 1019 1043 N/A INTRINSIC
RICTOR_phospho 1084 1189 4.06e-58 SMART
low complexity region 1221 1239 N/A INTRINSIC
low complexity region 1255 1266 N/A INTRINSIC
low complexity region 1273 1287 N/A INTRINSIC
low complexity region 1404 1414 N/A INTRINSIC
low complexity region 1464 1474 N/A INTRINSIC
low complexity region 1616 1628 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228266
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RICTOR and MTOR (FRAP1; MIM 601231) are components of a protein complex that integrates nutrient- and growth factor-derived signals to regulate cell growth (Sarbassov et al., 2004 [PubMed 15268862]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit embryonic lethality during organogenesis associated with abnormal placental morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Tg T G 15: 66,828,568 probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Rictor
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Rictor APN 15 6786590 missense probably damaging 0.99
IGL00785:Rictor APN 15 6776950 missense probably damaging 1.00
IGL00801:Rictor APN 15 6794534 missense probably damaging 1.00
IGL01072:Rictor APN 15 6789562 missense probably damaging 0.98
IGL01139:Rictor APN 15 6778268 missense probably damaging 1.00
IGL01303:Rictor APN 15 6708638 missense probably benign 0.10
IGL01307:Rictor APN 15 6774604 splice site probably null
IGL01767:Rictor APN 15 6777384 missense probably damaging 1.00
IGL01774:Rictor APN 15 6769777 missense probably damaging 1.00
IGL01800:Rictor APN 15 6774701 missense probably damaging 0.99
IGL02192:Rictor APN 15 6786414 missense probably benign 0.00
IGL02503:Rictor APN 15 6786443 missense probably benign 0.06
IGL02652:Rictor APN 15 6776187 critical splice donor site probably null
IGL02656:Rictor APN 15 6776920 missense probably damaging 0.98
IGL02752:Rictor APN 15 6787371 missense probably benign 0.02
IGL03000:Rictor APN 15 6769240 splice site probably benign
IGL03118:Rictor APN 15 6759518 missense possibly damaging 0.93
IGL03182:Rictor APN 15 6789598 missense probably benign 0.08
Tense UTSW 15 6759496 missense possibly damaging 0.94
Tonus UTSW 15 6769334 critical splice donor site probably null
Torrid UTSW 15 6759572 missense probably damaging 1.00
R0149:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0288:Rictor UTSW 15 6786540 missense probably benign 0.08
R0304:Rictor UTSW 15 6786371 splice site probably null
R0336:Rictor UTSW 15 6776753 critical splice acceptor site probably null
R0361:Rictor UTSW 15 6784107 missense possibly damaging 0.76
R0423:Rictor UTSW 15 6773900 missense possibly damaging 0.77
R0453:Rictor UTSW 15 6708642 missense probably benign 0.01
R0515:Rictor UTSW 15 6769301 missense probably damaging 1.00
R0630:Rictor UTSW 15 6794492 missense probably damaging 1.00
R0730:Rictor UTSW 15 6773986 splice site probably benign
R0744:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0836:Rictor UTSW 15 6764278 critical splice acceptor site probably null
R0881:Rictor UTSW 15 6791670 missense probably benign
R1114:Rictor UTSW 15 6794005 nonsense probably null
R1367:Rictor UTSW 15 6790638 splice site probably benign
R1678:Rictor UTSW 15 6756471 missense probably benign 0.07
R1679:Rictor UTSW 15 6768090 missense possibly damaging 0.92
R1754:Rictor UTSW 15 6735368 missense probably damaging 1.00
R1757:Rictor UTSW 15 6773862 missense possibly damaging 0.95
R1762:Rictor UTSW 15 6756573 missense probably benign 0.00
R1914:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1915:Rictor UTSW 15 6759572 missense probably damaging 1.00
R1994:Rictor UTSW 15 6776156 missense probably benign 0.18
R2145:Rictor UTSW 15 6765107 missense probably damaging 1.00
R2182:Rictor UTSW 15 6772204 missense probably damaging 0.96
R2191:Rictor UTSW 15 6759614 missense probably benign 0.04
R2357:Rictor UTSW 15 6783562 missense probably damaging 0.99
R2914:Rictor UTSW 15 6769995 critical splice donor site probably null
R3082:Rictor UTSW 15 6774857 missense probably benign 0.15
R3885:Rictor UTSW 15 6759610 missense probably damaging 1.00
R3900:Rictor UTSW 15 6789473 missense probably benign 0.01
R4376:Rictor UTSW 15 6786967 missense probably benign 0.00
R4611:Rictor UTSW 15 6787144 missense possibly damaging 0.75
R4644:Rictor UTSW 15 6777935 nonsense probably null
R4718:Rictor UTSW 15 6783160 missense possibly damaging 0.81
R4822:Rictor UTSW 15 6791680 missense probably benign 0.01
R4980:Rictor UTSW 15 6781660 missense probably damaging 1.00
R5034:Rictor UTSW 15 6768095 missense probably damaging 0.98
R5179:Rictor UTSW 15 6795940 missense probably damaging 1.00
R5386:Rictor UTSW 15 6789504 missense probably benign 0.37
R5532:Rictor UTSW 15 6789565 missense probably damaging 1.00
R5549:Rictor UTSW 15 6786910 missense probably damaging 1.00
R5715:Rictor UTSW 15 6750716 nonsense probably null
R5733:Rictor UTSW 15 6783104 missense probably benign
R5822:Rictor UTSW 15 6794006 missense probably benign 0.00
R5848:Rictor UTSW 15 6794006 missense probably benign 0.00
R5849:Rictor UTSW 15 6794006 missense probably benign 0.00
R5850:Rictor UTSW 15 6794006 missense probably benign 0.00
R5854:Rictor UTSW 15 6794006 missense probably benign 0.00
R5855:Rictor UTSW 15 6794006 missense probably benign 0.00
R5856:Rictor UTSW 15 6794006 missense probably benign 0.00
R5936:Rictor UTSW 15 6784161 missense probably damaging 0.99
R6155:Rictor UTSW 15 6793977 missense probably benign 0.44
R6394:Rictor UTSW 15 6769309 missense possibly damaging 0.59
R6549:Rictor UTSW 15 6796175 missense probably damaging 1.00
R6611:Rictor UTSW 15 6750659 missense probably damaging 1.00
R6657:Rictor UTSW 15 6759496 missense possibly damaging 0.94
R6705:Rictor UTSW 15 6794012 missense probably benign 0.00
R6819:Rictor UTSW 15 6796036 critical splice donor site probably null
R6985:Rictor UTSW 15 6772154 missense probably benign 0.27
R6989:Rictor UTSW 15 6772154 missense probably benign 0.27
R7016:Rictor UTSW 15 6774880 critical splice donor site probably null
R7030:Rictor UTSW 15 6708453 critical splice donor site probably null
R7066:Rictor UTSW 15 6772154 missense probably benign 0.27
R7067:Rictor UTSW 15 6772154 missense probably benign 0.27
R7216:Rictor UTSW 15 6769301 missense probably damaging 1.00
R7396:Rictor UTSW 15 6786981 missense not run
R7449:Rictor UTSW 15 6772154 missense probably benign 0.27
R7450:Rictor UTSW 15 6772154 missense probably benign 0.27
R7452:Rictor UTSW 15 6772154 missense probably benign 0.27
R7616:Rictor UTSW 15 6772154 missense probably benign 0.27
R7620:Rictor UTSW 15 6772154 missense probably benign 0.27
R7643:Rictor UTSW 15 6769269 nonsense probably null
R7699:Rictor UTSW 15 6772154 missense probably benign 0.27
R7700:Rictor UTSW 15 6772154 missense probably benign 0.27
R7749:Rictor UTSW 15 6772154 missense probably benign 0.27
R7750:Rictor UTSW 15 6772154 missense probably benign 0.27
R7751:Rictor UTSW 15 6772154 missense probably benign 0.27
R7753:Rictor UTSW 15 6772154 missense probably benign 0.27
R7841:Rictor UTSW 15 6772154 missense probably benign 0.27
R7894:Rictor UTSW 15 6772154 missense probably benign 0.27
R7897:Rictor UTSW 15 6772154 missense probably benign 0.27
R7898:Rictor UTSW 15 6772154 missense probably benign 0.27
R7937:Rictor UTSW 15 6772154 missense probably benign 0.27
R7944:Rictor UTSW 15 6772154 missense probably benign 0.27
R8062:Rictor UTSW 15 6772154 missense probably benign 0.27
R8063:Rictor UTSW 15 6772154 missense probably benign 0.27
R8094:Rictor UTSW 15 6772154 missense probably benign 0.27
R8119:Rictor UTSW 15 6772154 missense probably benign 0.27
R8134:Rictor UTSW 15 6772154 missense probably benign 0.27
R8166:Rictor UTSW 15 6769334 critical splice donor site probably null
R8324:Rictor UTSW 15 6745562 missense probably damaging 1.00
R8343:Rictor UTSW 15 6778319 critical splice donor site probably null
R8691:Rictor UTSW 15 6787032 missense probably damaging 1.00
R8859:Rictor UTSW 15 6783586 missense probably damaging 0.98
R8953:Rictor UTSW 15 6794447 missense probably benign 0.39
R8977:Rictor UTSW 15 6783085 missense probably benign
R9008:Rictor UTSW 15 6772129 splice site probably benign
R9369:Rictor UTSW 15 6744367 missense probably benign 0.00
R9563:Rictor UTSW 15 6768081 missense possibly damaging 0.83
R9695:Rictor UTSW 15 6786529 missense probably benign 0.00
X0020:Rictor UTSW 15 6756482 missense probably benign 0.32
X0060:Rictor UTSW 15 6786552 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- CCTTGGGTTTTATTGGTCCTGCATACT -3'
(R):5'- TCTCTAGGCTACTTACTGGAAAAGCGAA -3'

Sequencing Primer
(F):5'- GCATACTGTATTTGTCTCTGAAGTC -3'
(R):5'- AGTTAGGCCCATCTGTAAGC -3'
Posted On 2014-05-09