Incidental Mutation 'R1655:Tg'
ID189056
Institutional Source Beutler Lab
Gene Symbol Tg
Ensembl Gene ENSMUSG00000053469
Gene Namethyroglobulin
SynonymsTgn
MMRRC Submission 039691-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R1655 (G1)
Quality Score196
Status Not validated
Chromosome15
Chromosomal Location66670753-66850721 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to G at 66828568 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000126454 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065916] [ENSMUST00000163495] [ENSMUST00000164163] [ENSMUST00000166403] [ENSMUST00000168522] [ENSMUST00000171045] [ENSMUST00000171045]
Predicted Effect probably null
Transcript: ENSMUST00000065916
SMART Domains Protein: ENSMUSP00000070239
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
TY 50 97 5.9e-16 SMART
TY 118 165 5.59e-17 SMART
Pfam:Thyroglobulin_1 174 252 4e-9 PFAM
TY 317 363 4.36e-19 SMART
low complexity region 495 504 N/A INTRINSIC
TY 617 662 3.58e-15 SMART
TY 684 730 1.47e-16 SMART
TY 880 926 1.51e-4 SMART
TY 1029 1078 1.21e-12 SMART
TY 1106 1150 7.56e-5 SMART
TY 1167 1215 7.26e-16 SMART
low complexity region 1244 1255 N/A INTRINSIC
Pfam:GCC2_GCC3 1464 1509 2.7e-16 PFAM
TY 1519 1568 9.81e-13 SMART
Pfam:COesterase 2181 2717 8.4e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163495
SMART Domains Protein: ENSMUSP00000129868
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
TY 14 63 1.21e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164163
SMART Domains Protein: ENSMUSP00000127901
Gene: ENSMUSG00000022372

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
SH3 25 81 2.5e-6 SMART
SH2 82 166 4.1e-31 SMART
low complexity region 247 260 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000166403
Predicted Effect probably benign
Transcript: ENSMUST00000168522
SMART Domains Protein: ENSMUSP00000131865
Gene: ENSMUSG00000022372

DomainStartEndE-ValueType
low complexity region 23 40 N/A INTRINSIC
SH3 41 97 4.1e-4 SMART
SH2 98 182 6.67e-29 SMART
low complexity region 263 276 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000171045
SMART Domains Protein: ENSMUSP00000126454
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
internal_repeat_1 93 331 1.53e-6 PROSPERO
Pfam:COesterase 562 1098 2.1e-137 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172153
SMART Domains Protein: ENSMUSP00000128410
Gene: ENSMUSG00000053469

DomainStartEndE-ValueType
Pfam:COesterase 313 849 6e-140 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.3%
  • 10x: 96.0%
  • 20x: 91.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Thyroglobulin (Tg) is a glycoprotein homodimer produced predominantly by the thryroid gland. It acts as a substrate for the synthesis of thyroxine and triiodothyronine as well as the storage of the inactive forms of thyroid hormone and iodine. Thyroglobulin is secreted from the endoplasmic reticulum to its site of iodination, and subsequent thyroxine biosynthesis, in the follicular lumen. Mutations in this gene cause thyroid dyshormonogenesis, manifested as goiter, and are associated with moderate to severe congenital hypothyroidism. Polymorphisms in this gene are associated with susceptibility to autoimmune thyroid diseases (AITD) such as Graves disease and Hashimoto thryoiditis. [provided by RefSeq, Nov 2009]
PHENOTYPE: Mice homozygous for a spontaneous mutation exhibit enlarged thyroid gland, hypothyroidism, abnormal thyroid gland morphology, and decreased body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4833427G06Rik A T 9: 51,083,621 I136N probably damaging Het
9530053A07Rik A T 7: 28,147,110 N1076Y probably damaging Het
A730061H03Rik A T 14: 55,560,333 probably benign Het
Abca1 C T 4: 53,050,964 A1582T probably benign Het
Acot8 A T 2: 164,803,108 S52T probably benign Het
Atcay C T 10: 81,213,397 V124M probably damaging Het
Cep295 C T 9: 15,340,883 E397K probably damaging Het
Cfap46 A T 7: 139,642,520 Y1180* probably null Het
Clptm1 T A 7: 19,645,867 H148L probably benign Het
Clstn3 A G 6: 124,437,427 L743P probably damaging Het
Crtc3 A T 7: 80,598,776 M313K possibly damaging Het
Csgalnact1 T A 8: 68,373,689 I326F possibly damaging Het
Dennd6b G T 15: 89,196,340 T19K unknown Het
Disp1 A T 1: 183,087,004 I1284N probably benign Het
Dnah2 A G 11: 69,473,854 Y1992H probably damaging Het
Dnah6 C T 6: 73,205,732 V205I possibly damaging Het
Dst G T 1: 34,282,576 G4391* probably null Het
Dytn A G 1: 63,661,198 S258P probably damaging Het
Emilin3 T A 2: 160,910,866 probably null Het
Ermn C T 2: 58,052,584 V45I probably benign Het
Fat4 T C 3: 38,957,318 V2189A probably damaging Het
Filip1l T C 16: 57,571,851 I934T probably damaging Het
Gbp9 T A 5: 105,081,692 Q472L possibly damaging Het
Gimap5 G T 6: 48,753,176 E227* probably null Het
Gsdmc C T 15: 63,780,043 V240M probably benign Het
H2-Q4 G T 17: 35,382,905 V248F probably damaging Het
Helz2 T C 2: 181,234,147 E1518G probably damaging Het
Hmcn1 A G 1: 150,630,333 V3814A probably benign Het
Ifna7 A G 4: 88,816,660 T145A probably benign Het
Itgam T A 7: 128,115,163 M947K probably benign Het
Itpr2 T G 6: 146,376,148 N608H probably damaging Het
Klra2 T A 6: 131,220,211 N242I probably damaging Het
Lonrf2 A T 1: 38,811,824 L219Q probably damaging Het
Ly6c2 T C 15: 75,108,563 I126V probably benign Het
Mr1 G A 1: 155,132,455 T258M probably benign Het
Mrps35 T G 6: 147,060,228 D200E possibly damaging Het
Nbeal2 A C 9: 110,632,872 S1506A probably damaging Het
Ncoa7 T C 10: 30,698,245 probably null Het
Nlrp4a A T 7: 26,449,651 I228F possibly damaging Het
Olfr1047 A G 2: 86,228,080 V297A possibly damaging Het
Olfr1339 A G 4: 118,734,999 S157G probably benign Het
Olfr368 A G 2: 37,331,939 Y64C probably damaging Het
Olfr483 A T 7: 108,103,464 I52F probably damaging Het
Paxx T C 2: 25,460,316 E93G probably damaging Het
Per2 C A 1: 91,448,768 G128W probably damaging Het
Piezo1 A G 8: 122,496,822 I796T probably benign Het
Pkhd1 A G 1: 20,584,129 S235P probably damaging Het
Pole T A 5: 110,335,922 F259Y probably damaging Het
Pus7 T A 5: 23,747,800 K512* probably null Het
Ralyl A T 3: 14,107,236 Y55F probably damaging Het
Rgs14 T A 13: 55,383,534 M451K probably benign Het
Rhag T C 17: 40,831,596 F231L probably damaging Het
Ric8a T C 7: 140,860,895 C94R probably benign Het
Rictor T A 15: 6,772,212 D460E probably benign Het
Rpn1 T C 6: 88,100,944 V454A possibly damaging Het
Sacs A G 14: 61,191,782 D427G probably benign Het
Scai A T 2: 39,080,117 V545D possibly damaging Het
Serpinb3a A G 1: 107,046,212 V323A probably damaging Het
Slc13a5 C A 11: 72,257,378 C277F probably benign Het
Slc15a1 A T 14: 121,465,899 Y557N probably benign Het
Slc34a2 T C 5: 53,069,419 V628A probably benign Het
Slc8a2 G T 7: 16,141,135 G436V probably damaging Het
Sphkap G A 1: 83,277,515 R838* probably null Het
Supt5 T C 7: 28,330,024 I103V probably benign Het
Tdrd1 T A 19: 56,843,216 Y346* probably null Het
Top1 T A 2: 160,703,696 probably null Het
Trmt12 T C 15: 58,873,227 L158P probably damaging Het
Tssk4 A G 14: 55,651,695 N226S probably damaging Het
Unc80 G T 1: 66,672,756 V2746F possibly damaging Het
Usp34 T A 11: 23,375,051 V999E probably benign Het
Virma T C 4: 11,494,786 V29A probably damaging Het
Zfp40 A T 17: 23,177,266 Y48N probably benign Het
Zfp609 A G 9: 65,703,554 V709A possibly damaging Het
Other mutations in Tg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00157:Tg APN 15 66847166 missense probably damaging 1.00
IGL00230:Tg APN 15 66827290 missense probably benign 0.00
IGL00324:Tg APN 15 66693424 missense probably benign
IGL00428:Tg APN 15 66773424 missense probably benign 0.33
IGL00703:Tg APN 15 66696489 missense probably benign 0.34
IGL00808:Tg APN 15 66683813 missense probably damaging 1.00
IGL00833:Tg APN 15 66688801 missense probably benign 0.34
IGL00899:Tg APN 15 66674073 critical splice donor site probably null
IGL00921:Tg APN 15 66764453 missense probably benign 0.28
IGL00975:Tg APN 15 66681882 missense probably benign
IGL01288:Tg APN 15 66736276 missense possibly damaging 0.81
IGL01397:Tg APN 15 66696092 splice site probably benign
IGL01634:Tg APN 15 66729566 missense probably benign 0.34
IGL01646:Tg APN 15 66678087 missense probably damaging 1.00
IGL01704:Tg APN 15 66671351 missense probably damaging 0.98
IGL01958:Tg APN 15 66759486 missense probably benign 0.06
IGL02093:Tg APN 15 66692374 missense possibly damaging 0.83
IGL02113:Tg APN 15 66705330 missense probably benign 0.08
IGL02138:Tg APN 15 66717233 missense probably benign 0.01
IGL02156:Tg APN 15 66705348 missense probably benign 0.19
IGL02169:Tg APN 15 66757943 missense probably benign 0.04
IGL02342:Tg APN 15 66764291 missense probably benign
IGL02434:Tg APN 15 66764342 missense probably damaging 0.97
IGL02506:Tg APN 15 66741594 missense possibly damaging 0.71
IGL02513:Tg APN 15 66705274 missense probably benign
IGL02549:Tg APN 15 66839361 missense probably damaging 1.00
IGL02669:Tg APN 15 66748726 splice site probably benign
IGL02756:Tg APN 15 66734586 missense probably benign
IGL02800:Tg APN 15 66757886 missense probably damaging 1.00
IGL02828:Tg APN 15 66682394 missense probably damaging 1.00
IGL02927:Tg APN 15 66678093 missense probably damaging 1.00
IGL03061:Tg APN 15 66671405 missense probably damaging 1.00
IGL03105:Tg APN 15 66715106 missense probably benign 0.01
IGL03160:Tg APN 15 66839303 nonsense probably null
IGL03242:Tg APN 15 66683798 missense probably damaging 0.99
Also_ran UTSW 15 66678839 missense probably damaging 1.00
bedraggled UTSW 15 66740714 missense probably damaging 1.00
hognose UTSW 15 66717208 missense probably damaging 0.99
ito UTSW 15 66766162 nonsense probably null
ito2 UTSW 15 66671396 missense probably damaging 1.00
ito3 UTSW 15 66773474 missense probably damaging 1.00
ito4 UTSW 15 66696520 missense possibly damaging 0.47
Papua UTSW 15 66674050 missense probably damaging 1.00
pipistrella UTSW 15 66696135 missense probably damaging 1.00
samarai UTSW 15 66758006 critical splice donor site probably null
sariba UTSW 15 66694870 missense probably benign 0.01
ticker UTSW 15 66827382 nonsense probably null
vampire UTSW 15 66682827 missense probably damaging 1.00
IGL03134:Tg UTSW 15 66740718 missense probably damaging 1.00
P0019:Tg UTSW 15 66688863 missense probably benign 0.01
R0121:Tg UTSW 15 66740781 missense probably benign 0.04
R0135:Tg UTSW 15 66694870 missense probably benign 0.01
R0227:Tg UTSW 15 66698446 missense possibly damaging 0.84
R0448:Tg UTSW 15 66764442 missense probably damaging 1.00
R0453:Tg UTSW 15 66828533 missense probably benign 0.09
R0504:Tg UTSW 15 66682404 missense probably damaging 0.97
R0543:Tg UTSW 15 66729597 missense probably benign 0.13
R0638:Tg UTSW 15 66717208 missense probably damaging 0.99
R0639:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0646:Tg UTSW 15 66729626 missense probably damaging 0.99
R0666:Tg UTSW 15 66737521 missense probably benign
R0673:Tg UTSW 15 66741484 critical splice acceptor site probably null
R0689:Tg UTSW 15 66839404 splice site probably benign
R0704:Tg UTSW 15 66757880 missense probably benign 0.02
R0730:Tg UTSW 15 66678789 missense probably damaging 1.00
R0830:Tg UTSW 15 66725144 missense probably damaging 1.00
R0959:Tg UTSW 15 66708010 missense probably damaging 0.98
R1027:Tg UTSW 15 66672409 missense possibly damaging 0.65
R1061:Tg UTSW 15 66698559 missense probably benign 0.09
R1086:Tg UTSW 15 66684062 missense probably benign
R1103:Tg UTSW 15 66719655 missense probably benign 0.45
R1240:Tg UTSW 15 66828548 missense probably benign 0.16
R1281:Tg UTSW 15 66696489 missense probably benign 0.34
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1470:Tg UTSW 15 66849463 missense possibly damaging 0.95
R1531:Tg UTSW 15 66850502 missense probably benign 0.02
R1544:Tg UTSW 15 66705232 missense probably benign 0.04
R1550:Tg UTSW 15 66693430 missense possibly damaging 0.52
R1575:Tg UTSW 15 66729685 critical splice donor site probably null
R1638:Tg UTSW 15 66696166 nonsense probably null
R1671:Tg UTSW 15 66692387 missense possibly damaging 0.89
R1789:Tg UTSW 15 66737548 missense probably benign 0.00
R1883:Tg UTSW 15 66671309 missense probably damaging 1.00
R1984:Tg UTSW 15 66682842 missense probably benign
R2063:Tg UTSW 15 66828553 missense probably damaging 1.00
R2092:Tg UTSW 15 66849607 missense probably null 0.26
R2109:Tg UTSW 15 66729594 missense probably benign 0.02
R2128:Tg UTSW 15 66694894 missense probably benign 0.10
R2129:Tg UTSW 15 66694894 missense probably benign 0.10
R2207:Tg UTSW 15 66681939 missense probably benign 0.15
R2219:Tg UTSW 15 66681933 missense probably benign 0.03
R2228:Tg UTSW 15 66674011 missense probably damaging 0.99
R2229:Tg UTSW 15 66674011 missense probably damaging 0.99
R2259:Tg UTSW 15 66683898 missense probably benign
R2994:Tg UTSW 15 66681953 missense probably benign
R3904:Tg UTSW 15 66766162 nonsense probably null
R3946:Tg UTSW 15 66674023 missense probably damaging 1.00
R3965:Tg UTSW 15 66684190 missense probably benign
R4245:Tg UTSW 15 66696469 missense possibly damaging 0.68
R4451:Tg UTSW 15 66766147 missense probably benign 0.01
R4487:Tg UTSW 15 66671396 missense probably damaging 1.00
R4489:Tg UTSW 15 66707942 missense probably damaging 1.00
R4623:Tg UTSW 15 66735271 missense probably benign 0.23
R4659:Tg UTSW 15 66673920 missense possibly damaging 0.67
R4728:Tg UTSW 15 66682827 missense probably damaging 1.00
R4760:Tg UTSW 15 66693319 missense probably damaging 1.00
R4797:Tg UTSW 15 66758006 critical splice donor site probably null
R4944:Tg UTSW 15 66764337 missense probably damaging 1.00
R4998:Tg UTSW 15 66674050 missense probably damaging 1.00
R5009:Tg UTSW 15 66696586 missense probably benign 0.01
R5025:Tg UTSW 15 66707930 missense probably damaging 1.00
R5035:Tg UTSW 15 66681813 splice site probably null
R5049:Tg UTSW 15 66827382 nonsense probably null
R5073:Tg UTSW 15 66735252 missense probably benign 0.05
R5169:Tg UTSW 15 66678780 nonsense probably null
R5185:Tg UTSW 15 66773474 missense probably damaging 1.00
R5227:Tg UTSW 15 66759567 missense possibly damaging 0.87
R5300:Tg UTSW 15 66678855 missense probably damaging 1.00
R5334:Tg UTSW 15 66678055 missense probably damaging 1.00
R5339:Tg UTSW 15 66678093 missense probably damaging 1.00
R5402:Tg UTSW 15 66739168 missense probably damaging 0.98
R5441:Tg UTSW 15 66696520 missense possibly damaging 0.47
R5509:Tg UTSW 15 66827293 missense probably benign 0.45
R5580:Tg UTSW 15 66685300 missense possibly damaging 0.66
R5582:Tg UTSW 15 66693435 missense probably damaging 1.00
R5624:Tg UTSW 15 66838057 missense probably benign 0.11
R5686:Tg UTSW 15 66688889 missense probably benign 0.28
R6042:Tg UTSW 15 66683993 missense probably benign 0.01
R6122:Tg UTSW 15 66828457 missense probably damaging 1.00
R6146:Tg UTSW 15 66673367 splice site probably null
R6159:Tg UTSW 15 66735247 missense possibly damaging 0.71
R6223:Tg UTSW 15 66707922 missense probably benign 0.15
R6480:Tg UTSW 15 66671311 missense probably damaging 1.00
R6505:Tg UTSW 15 66759558 missense probably damaging 0.99
R6531:Tg UTSW 15 66839362 missense probably damaging 0.99
R6614:Tg UTSW 15 66735259 missense probably damaging 0.99
R6698:Tg UTSW 15 66839362 missense probably damaging 1.00
R6798:Tg UTSW 15 66678839 missense probably damaging 1.00
R6837:Tg UTSW 15 66696135 missense probably damaging 1.00
R6861:Tg UTSW 15 66688891 missense probably benign 0.00
R6888:Tg UTSW 15 66696246 missense probably damaging 0.99
R6933:Tg UTSW 15 66764309 missense possibly damaging 0.73
R6983:Tg UTSW 15 66693358 missense probably benign 0.01
R7078:Tg UTSW 15 66673543 missense probably damaging 1.00
R7244:Tg UTSW 15 66740714 missense probably damaging 1.00
R7320:Tg UTSW 15 66694784 missense possibly damaging 0.71
R7334:Tg UTSW 15 66725272 missense probably benign 0.01
R7418:Tg UTSW 15 66696583 missense probably damaging 0.99
R7485:Tg UTSW 15 66696588 missense probably benign 0.04
R7524:Tg UTSW 15 66696161 missense probably benign 0.01
R7529:Tg UTSW 15 66694768 missense probably damaging 0.99
R7540:Tg UTSW 15 66689927 missense probably benign 0.16
R7583:Tg UTSW 15 66764418 missense probably damaging 1.00
R7594:Tg UTSW 15 66729583 missense probably benign 0.20
R7667:Tg UTSW 15 66715163 missense probably damaging 0.98
R7722:Tg UTSW 15 66764309 missense possibly damaging 0.73
T0975:Tg UTSW 15 66688863 missense probably benign 0.01
X0005:Tg UTSW 15 66688863 missense probably benign 0.01
X0065:Tg UTSW 15 66682454 missense probably damaging 1.00
X0067:Tg UTSW 15 66748743 missense probably benign 0.10
Predicted Primers PCR Primer
(F):5'- TGTCATGAGATGTCCTGCTTGCC -3'
(R):5'- AACTGTCCTAGTTCTGACCCCAGC -3'

Sequencing Primer
(F):5'- CAGAACCATGAGTGCTTTGC -3'
(R):5'- GCTTCCCCCATGACTATCTTCAG -3'
Posted On2014-05-09